1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
14

It is possible to see the effects of weathering. TRUE OR FALSE

Biology
1 answer:
Y_Kistochka [10]3 years ago
5 0

answer is TRUE........

You might be interested in
What is the name of the trait that hides or masks another genetic trait?
Hoochie [10]
A dominant trait will mask a recessive trait.
3 0
3 years ago
Gray matter consists of the ______ of neurons
laila [671]

Gray matter consists of the <u>unmyelinated axons</u> of neurons.

<u>Explanation:</u>

The outer layer of the brain consists of the grey matter and white matter. The grey matter gets its name by the pinkish grey colour obtained by the greyish colour of the neurons and the red colour from the capillaries.

The grey matter consists of the dentrites, axons and cell bodies and this is essential for memory, attention and learning.  

The unmyelinated axons are not covered by the fat protein myelin and these axons carry signals.They are the ones to help the processing of information in the brain.  

5 0
4 years ago
Read 2 more answers
Which factor would increase the production of glucose by photosynthesis<br><br> Please help!!!
maks197457 [2]

Answer:

freezing temperatures

5 0
3 years ago
Read 2 more answers
A force on an object pulling it towards the center of the earth is called
anyanavicka [17]
Hello. a force on an object pulling it towards the center of the earth is known as gravitational force. hope you benefited from it. reply.

5 0
4 years ago
Read 2 more answers
Which of the following is an example of geographic isolation?
Brut [27]

Answer:

B

Explanation:

This answer is the only one with something to do with geographical features.

7 0
3 years ago
Read 2 more answers
Other questions:
  • A biologist gathered date to show the interaction of the golden-cheeked warbler and juniper tree populations. Which conclusion d
    12·2 answers
  • Describe the impact of a waterborne pollutant on an aquatic community. write a 100-word report on how that pollutant affected aq
    5·1 answer
  • What happens to the temperature when the atmospheric co2 level increases in this model?
    15·1 answer
  • Which best summarizes the peppered moths in England after the Industrial Revolution?
    7·2 answers
  • What would be an adoption in a rain forest but not in a tundra
    10·1 answer
  • Classify the following under the headings 'cell structure', 'tissue', 'organ' or 'system'.
    5·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Which of the following structures have a role in plant reproduction?
    12·2 answers
  • Describe the similarities between polar and nonpolar steroid hormones.
    11·1 answer
  • A gene that controls betacarotene production has been successfully inserted into a common food crop. Name the technique used to
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!