All categories

3 years ago

Light energy travels as -

Biology

2 answers:

vichka [17]3 years ago

6 0

It would be transverse waves !

pochemuha3 years ago

6 0

Answer:

Explanation:

You might be interested in

A small farm pond containing many species of microorganisms (bacteria, cyanobacteria, algae, and protozoa was perturbed when run

jasenka [17]

If it grows lager there will be less room

4 0

3 years ago

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

In one butterfly species, the colors of individuals range from white to black, with many shades of gray in between. If the butte

Klio2033 [76]

Answer: Incomplete dominance

Explanation:

Incomplete dominance describes the force behind the emergence of an heterozygous phenotype (gray-coloured butterflies) as offspring of two contrasting homozygous phenotypes (white-coloured and black-coloured parent butterflies)

Furthermore, incomplete dominance set in when neither of the parent traits is dominant over the other.

Thus, gray-colour appear as an intermediate of the white-colour and black-colour

5 0

3 years ago

Can you elaborate after choosing?

Paul [167]

Fibrosis patient may suffer from the blood clotting when exposed to air

c- the blood clotting when exposed to air

<u>Explanation:</u>

Fibrosis is the development of excess fibrous connective tissue in an organ or in a reparative or responsive procedure. It is a sort of interstitial lung illness. It is brought about by lung tissue getting thick and solid and in the long run framing scar tissue inside the lungs.

Platelets ordinarily start the thickening procedure when they'reexposed to the air, for example, in a cut or wound. Blood clumps structure when certain pieces of your blood thicken, shaping a semisolid mass. This procedure might be activated by damage or it can here and there happen inside veins that don't have conspicuous damage.

In people, cell parts make up roughly 45 percent of the blood and the fluid plasma 55 percent. Be that as it may, some of the time blood clumps structure too effectively or doesn't break down appropriately and travel through the body restricting or blocking bloodstream. This is called over the top blood thickening or hypercoagulation and can be perilous and prompts Fibrosis.

4 0

3 years ago

When you see wood burning, what evidence do you observe that a

egoroff_w [7]

I feel like 5 is one of the answers

4 0

3 years ago

Read 2 more answers