1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
6

Which type of receptor binds to ligands that cannot enter the cell?

Biology
1 answer:
BabaBlast [244]3 years ago
3 0

Answer:

A membrane

Explanation:

You might be interested in
_____ breaks down carbohydrates into simple sugars
Alex777 [14]

Answer: amylase

Explanation:

4 0
3 years ago
In a factory there are many times that need to be performed someone has to order in stock supplies that are needed for the facto
Tomtit [17]

Answer:

The correct answer is cells can do more in less time.

Explanation:

Human body has developed specialized cell so that specific cells can carry out specific functions of the complex human body system.

      Each body cells are specialized for their specific function for example heart cells act as pump,lung cells helps in gas exchange,blood cells helps in transport of biomolecules,muscle cells helps in the contraction and relaxation.

  Thus the numerous functions of human body are divided among specific cell so that each cell will have low work load and can carry out their specific functions in less time.

3 0
3 years ago
Which statement describes Mendel’s hypotheses regarding gametes?
olchik [2.2K]

Answer:

C

Explanation:

Because i got it right

3 0
3 years ago
Read 2 more answers
What is it called when a cell reproduces?
Darya [45]
It is called cell division
5 0
3 years ago
Which law regulates pesticides and herbicides? a. Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) of 1947 b. Federal
seropon [69]

The law that regulates pesticides and herbicides in the USA is the Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) of 1947. This law prohibits the use of certain compounds as pesticides.

The Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) law is a regulatory law that provides a suitable federal regulatory framework for the use, distribution and sale of pesticides.

This law (FIFRA) is aimed at protecting pesticide users, consumers, and the environment.

The pesticides used in the USA must be licensed by the US Environmental Protection Agency (EPA).

Learn more in:

brainly.com/question/1604022

4 0
2 years ago
Other questions:
  • Which of the following statements concerning correlation analysis is not true
    12·2 answers
  • In humans, straight hair can be represented as ss and curly hair as ss. hair texture exhibits incomplete dominance. a man with c
    13·2 answers
  • What is the role of deoxyribonucleic acid (DNA) in organisms?
    9·1 answer
  • Which type of solution would cause a bacterium with a weak or damaged cell wall to burst as water moves into the cell? view avai
    8·1 answer
  • A rat becomes a long tailed rat and a short tailed rat over 10000 years. What is this called ?
    7·2 answers
  • Antibiotics are most effective in killing
    11·2 answers
  • Give an example of how each organism might use the energy produced by chemical reactions.
    13·1 answer
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • Please select the word from the list that best fits the definition
    13·1 answer
  • how do the atoms in carbon dioxide and water are rearranged during photosynthesis to yield glucose and molecular oxygen.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!