1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
6

1. How many pounds of biological material is below that soil surface?​

Biology
1 answer:
Stella [2.4K]3 years ago
8 0

Answer:

The amount of organic matter in mineral (sand, loam or clay) soils ranges from very low being 1% by weight, to average being 2 to 4%, and high being greater than 5%. There are also “muck” or organic or peat based soils that are 30 to 40% organic matter. The general consensus is the more soil organic matter the better.   approximately 45%

Soil Composition

The basic components of soil are minerals, organic matter, water and air. The typical soil consists of approximately 45% mineral, 5% organic matter, 20-30% water, and 20-30% air. These percentages are only generalizations at best.

Explanation:

You might be interested in
What is osmosis? in your own words
Firdavs [7]
Movement of water through a plasma membrane from a low to high solute concentration.
5 0
3 years ago
Read 2 more answers
Need help on this plz
djyliett [7]

Answer:69

Explanation:

4 0
3 years ago
What is the first part of the eye that light hits.
DaniilM [7]
The iris I the first part of the eye that light hits.
8 0
3 years ago
What is the definition of osmosis
Korvikt [17]
Osmosis is basically the spread of water across a particular absorbent membrane.
7 0
3 years ago
Read 2 more answers
All of the following are regulatory functions of the endocrine system except Select one: a. labor contractions. b. development o
aleksley [76]

Answer:

c. immune functions.

Explanation:

The endocrine system is involved in the regulation of metabolic rate, body temperature (thermoregulation), tissue development and labor contractions except immune functions.

Studies have shown that no hormone has been identified as being important in the regulation of the immune system. Therefore immune functions is not a regulatory function of the endocrine system.

Although, there have been articles on the endocrine and immune system crosstalk, only a hypothesis of various proteohormones not single hormones have been discovered to act on immunocompetent cells.

4 0
3 years ago
Other questions:
  • DNA strand: TTTTCGCGATATGCTGGT The following set of protein chains (amino acids) were created by mutating one nucleotide in the
    11·1 answer
  • Which two organs help to break food down mechanically?
    13·2 answers
  • The planets Hox and Blox are near each other in the Dorgon system. The Dorgons have very advanced technology, and a Dorgon scien
    15·1 answer
  • This is a substance that is required in large amounts for survival and sustainability.
    5·1 answer
  • Which of the following describes an innate animal behavior
    11·1 answer
  • A gene is composed of two alleles. An allele can be either dominant or recessive. Suppose that a husband and​ wife, who are both
    7·1 answer
  • AQUATICS SCIENCE I need help
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Claim <br> What makes diamonds so special?
    6·2 answers
  • jansman, a. j., verstegen, m. w., huisman, j., and van den berg, j. w. 1995. effects of hulls of faba beans (vicia faba l.) with
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!