1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
10

As a part of the life cycle of plants, the plant must begin with an embryo. What statement best describes where the embryo can b

e found in flowering and non-flowering plants?
Biology
1 answer:
nydimaria [60]3 years ago
6 0

The missing statements are given as follows:

a. In a flowering plant, the embryo is in seeds found in the flower, and in non-flowering plants, the embryo is in seeds found in the cone.

b. In a non-flowering plant, the embryo is in spores found in the stem, and in a flowering plant, the embryo is in seeds found in the flower.

c. In a non-flowering plant, the embryo is in seeds in the leaves, and in a flowering plant, the embryo is in seeds found in the spores.

d. In a flowering plant, the embryo is in spores found in the flower, and in a non-flowering plant, the embryo is in seeds found in the spores.

Answer:

The correct answer is - option a. In a flowering plant, the embryo is in seeds found in the flower, and in non-flowering plants, the embryo is in seeds found in the cone.

Explanation:

Non-flowering plants especially gymnosperms begin their life cycles from the embryo found inside the seeds like the flowering plants however, in gymnosperms these are found in the cone.

In the flowering plants, the embryo is present in the seeds present in the flower that develop into fruits too. Angiosperms are the flowering plants that produce seeds.

Thus, the statement best describes where the embryo can be found in flowering and non-flowering plants.

You might be interested in
What is responsible for most of the atmospheric circulation?
Ivahew [28]

The answer is A. The main driver of the convention in atmospheric circulation is the suns energy. When the sun heats the earth, the atmosphere directly below the sun gets heated more and faster compared to other regions causing an area of low pressure. This hot air mass rises and is replaced by cooler air masses (from high-pressure regions) from neighboring regions. This, essentially, causes winds and air currents.






4 0
4 years ago
"a lake is one example of local base level.<br> a. true<br> b. false"
nikklg [1K]
The answer is true hope this helps
7 0
3 years ago
The structure of a human skin cell differs from that of a human muscle cell. The two cells most likely have different __________
AnnyKZ [126]

Answer:

The correct answer would be - functions.

Explanation:

The structure of the skin cells and muscle cells are different and have a different number of cell organelles on their role in the body. Skin cells are a special type of cells that keep on shedding and replaced by new ones therefore they need less energy and have many mitochondria.

In contrast, muscle cells have different structures as they need a high amount of energy to make movements and therefore have lots of mitochondria in the cell.

7 0
3 years ago
What can be a solution for air pollution
Leni [432]

Answer:

The most basic solution for air pollution is to move away from fossil fuels, replacing them with alternative energies like solar, wind and geothermal. Producing clean energy is crucial. But equally important is to reduce our consumption of energy by adopting responsible habits and using more efficient devices.

Explanation:

8 0
3 years ago
Read 2 more answers
Organisms, like bacteria or lichen, that can live on bare rock and form soil are called
vovikov84 [41]
Organisms, like bacteria or lichen, that can live on bare rock and form soil are called Pioneer species. In primary succession pioneer species like lichen, algae, bacteria , fungi as well as other abiotic factors like water and wind, start to normalize the habitat. This type of successions begins on rock formations, such as mountains or volcanoes, or in a place with no organisms or soil. 
8 0
3 years ago
Other questions:
  • How has pollution associated with milk production changed in the past 200 years
    7·1 answer
  • The atomic mas of an element whose atoms consist of eight protons,nine neutrons and eight electrons is
    9·1 answer
  • 1. What is a moments of a force?
    9·1 answer
  • If an object measures 29000 pm, how long is it in mm?
    9·2 answers
  • The substrate in the C test tubes is
    10·1 answer
  • If a course includes an online textbook/e-book under which link can it be found?
    15·2 answers
  • Interactions between organisms and their environment impact the organism’s overall population. The jaguar Panthera onca is the l
    8·2 answers
  • If the genotype for hair color was B for brown and b for blonde, what would the genotype be for a person who was homozygous rece
    11·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • GIVING BRAINLIEST AND 20 POINTS PLS HELP lol
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!