Lantana can cause death in cattle. how long does this process take?

1 answer:

5 0

The correct option is C.
Lantana is a tropical evergreen shrub which is usually cultivated as ornamental flowers. It is a plant that threatening livestock especially in Australia. The signs of lantana poisoning in livestock include: excessive skin sensitivity to sunlight, liver damage, yellow coloration of the white part of the eyes, reddening of the eyes, swelling of the ears, etc.
If the poisoning case is severe, the animal death will occur between two to four days, but generally, untreated animals usually die within one to three weeks.

You might be interested in

When a muscle is stimulated to contract aerobically, less lactic acid is formed than when it contracts anaerobically because:___

lyudmila [28]

Answer:

5. under aerobic conditions most of the pyruvate generated as a result of glycolysis is oxidized by the citric acid cycle rather than reduced to lactate.

Explanation:

The contraction of muscles occurs in the presence of Adenosine Triphosphate (ATP) because ATP supplies the muscles with the energy they require for contraction.

Muscles can undergo contraction Aerobically ( in the presence of oxygen) or Anaerobically ( in the absence of oxygen).

When a muscle is stimulated to contract aerobically, less lactic acid is formed than when it contracts anaerobically because under aerobic conditions most of the pyruvate generated as a result of glycolysis is oxidized by the citric acid cycle rather than reduced to lactate.

4 0

3 years ago

How are nucleus and chloroplasts different?

Kamila [148]

Answer:

Chloroplasts are endosymbiotic descendants of photosynthetic cyanobacteria-like prokaryotes that were incorporated into cells more than a billion years ago.

Explanation:

Photosynthesis converts electrochemical energy from light into sugars and acts as the carbon source of the cell.

4 0

3 years ago

Read 2 more answers

The conversion of nitrogen gas to compounds useful to crops is called _____.

stiv31 [10]

Nitrification or nitrogen fixation

8 0

3 years ago

There is a certain grammar to the genetic code, or

Mademuasel [1]

Answer:

Codons are

base "words" that code for specific amino acids. They are

nonoverlapping

and never

have gaps between

the words.

Explanation:

6 0

3 years ago

Read 2 more answers

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago