1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
4 years ago
11

How frequently can scientists prove that their hypotheses are true?

Biology
1 answer:
ZanzabumX [31]4 years ago
4 0
Scientists prove their hypothesis is true about Scientists can never "prove" their hypotheses are true, because some future experiment, possibly using new technology not currently available, might show the hypothesis to be false after all.
You might be interested in
The aorta, which carries oxygen–rich blood from the heart to all parts of the body, is a part of which circulation pathway?. . A
expeople1 [14]
<span>B. pulmonary circulation

This is the circulatory system that brings blood into the heart and pumped it out to the entire body through systems of branching out veins and arteries. The aorta is the primary artery, like a major river, which then flows the oxygenated blood out into smaller arteries and veins.</span>
8 0
3 years ago
1 Point
Naddika [18.5K]
Access to clean water and sanitation of waste
4 0
3 years ago
What is an example of a sororal connection? A. a father and mother set of porpoises B. a group of female bottlenose dolphins C.
astraxan [27]
B. a group of female bottlenose dolphins... because when its sororal it means sister to sister

8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
3. When oxygen in a person's blood decreases, the body will respond by...
Svetradugi [14.3K]
Decrease breathing rate hope it helps
6 0
3 years ago
Other questions:
  • We can acquire new behaviors without direct exposure to contingencies through _______.
    13·1 answer
  • Which of the following muscles act(s) to increase the size of the thoracic cavity during inhalation? 1. diaphragm 2. external in
    6·1 answer
  • Chicken must be cooked to an internal temperature of 165°f. why must chicken be cooked to this temperature?
    5·2 answers
  • When a drug is discontinued, what percentage of that drug will remain in the body after three half-lives?
    8·1 answer
  • Why would bass and crayfish benefit form an increased level of phosphate
    7·2 answers
  • Drag and drop a term to match these examples with the correct level of organization.
    10·1 answer
  • Which is located at the beginning of a gene?
    9·2 answers
  • PLEASE HURRY!! I will give brainliest!! what is one factor of rock types that affects the rate of weathering?
    5·1 answer
  • If 15% of a DNA sample is made up of thymine, T,what percentage of the sample is made up of cytosine, C?
    14·1 answer
  • Identify 3 conditions that can develop from having or missing chromosomes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!