1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
2 years ago
11

What are the interacting spheres of the earth and what is cycled between these spheres?

Biology
2 answers:
Kitty [74]2 years ago
6 0

Answer: The Earth's Carbon Cycle is the biogeochemical exchange of carbon between the earth's five main physical “spheres”—atmosphere, biosphere, pedosphere, hydrosphere and lithosphere.

Explanation:

cause in space spheres is like ice that freezes in outer space

natka813 [3]2 years ago
6 0

Atmosphere

Hydrosphere

Lithosphere

Biosphere

You might be interested in
Whats an accurate description on what science is
postnew [5]
I would say that Science is the term for collected studies on the creation of all things and how time affects them.
3 0
3 years ago
How do humans affect biomass<br><br> Pls help me I can’t find anything
Nimfa-mama [501]

Answer:It includes the human-initiated burning of vegetation for land clearing and land-use change as well as natural, lightning-induced fires. Scientists estimate that humans are responsible for about 90% of biomass burning with only a small percentage of natural fires contributing to the total amount of vegetation burned.

Explanation:

i just copied and pasted it off the internet sooo.... yeah

5 0
3 years ago
How does carbon move through the system when in the dark?
Ksju [112]
If referring to photosynthesis, carbon dioxide is brought into the cholorplast of the plant cell, it is then fixed to RUBP, it will go through a series of Redox reactions and become G3P. RUBP is then recycled and is used to fix more carbon dioxide. You need two G3P molecules to become glucose.
7 0
3 years ago
A major change that occurred in the evolution of eukaryotic cells from prokaryotic cells was the development of?
slamgirl [31]
A membrane bound nucleus (or just a nucleus in general)
7 0
3 years ago
Is C6H5F organic or inorganic
Andru [333]

Answer: organic

Explanation: Its melting point is -44 °C

7 0
3 years ago
Read 2 more answers
Other questions:
  • During the light- dependent reaction of photosynthesis light energy is coverted into form of energy?
    12·1 answer
  • The temperature at which half of the dna helical structure is lost is called the:
    8·1 answer
  • What is genetic drift? view available hint(s) what is genetic drift? the motion of continental plates over time the physical spl
    6·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is clonal selection?
    15·1 answer
  • Why Lamarckism was rejected after darwinism?
    15·1 answer
  • Which part of cellular respiration must occur before any of the other steps can occur
    14·2 answers
  • Which of the following is NOT a nitrogenous base found in DNA?
    8·2 answers
  • Living systems are organized in levels according to their structures and functions.
    11·1 answer
  • members of the _____ movement would be very concerned about the unequal exposure of members of a certain race to pollution.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!