1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
13

1.

Biology
2 answers:
marta [7]3 years ago
8 0

Answer:

hydropower wind and bio mass

Explanation:

the government has registered them as renewable energy

Anna35 [415]3 years ago
6 0

The renewable resources are wind energy, biomass energy, and hydropower.  Coal energy is not renewable.

You might be interested in
In which situation is the principle of cross-cutting relationships useful in determining relative age?
Rzqust [24]

Answer: Igneous rock forms between sedimentary layers.

This can definitely help in determining relative age because sedimentary rocks will be the older rock than igneous rock as igneous rock has formed between sedimentary rocks

Explanation:

8 0
3 years ago
A cell that can capture energy from sunlight or chemicals and use it to produce its own food from inorganic compounds.
Eduardwww [97]
Producer/autotroph (i think)
5 0
3 years ago
Read 2 more answers
Which specimen had tiny hind legs with a mobile knee and several toes and lived 35-40 mya? Basilosaurus Pakicetus Sinonyx Ambulo
Gelneren [198K]
This answer to this question is <span>Basilosaurus. This was </span><span>a </span>genus<span> of prehistoric </span>cetacean. It lived<span> during the </span>Late Eocene<span> 40 to 35 </span>million years ago<span>. This species had tiny hind limbs and only three toes. To illustrate,</span> a<span> 16 m  individual</span><span> had 35 cm long hind limbs with fused tarsals and only three digits.</span> 
5 0
3 years ago
What are fungi? Give three examples.
MAXImum [283]

Answer:

Yeasts

mold

mushrooms

Explanation:

brainliest?

3 0
3 years ago
Read 2 more answers
What is the origin of the term cloning?<br> What were the first ideas related to this term
emmainna [20.7K]
The word 'clone' is derived from the greek term 'klon', or 'twig', referring to the fact that twigs have the capabilities to grow entire new plants.
6 0
3 years ago
Other questions:
  • What loop prevention technique is implemented by distance vector routing protocols?
    13·1 answer
  • What is a tertiary consumer
    6·1 answer
  • What is chragaff rule on DNA pairing
    10·1 answer
  • What property of water results from its high boiling point?
    8·2 answers
  • What form of energy is used to make photosynthesis happen?A. Solar energy
    11·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Explain why all types of evidence can be useful in court.
    6·1 answer
  • What is the % of water inside the cell
    15·1 answer
  • What does cellular respiration provide that plants can use in photosynthesis
    5·2 answers
  • Food must be broken down into________
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!