1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
3 years ago
9

An equation and the first step in its solution are shown: Equation: x2 + 8x - 9 = 0

Mathematics
1 answer:
Novay_Z [31]3 years ago
3 0
Answer- A-16

Because when doing completing the square, you divide the coefficient of x by 2, which is 4, and the square it which is 16
You might be interested in
Pls help extra points and mark brainlist
attashe74 [19]

Answer:

12

Step-by-step explanation:

The range is the difference from the greatest data point and the least data point. By looking at the box plot, the lowest value would be 0 while the highest would be 12. You use the definition of range to find it:

12 - 0 = 12

3 0
3 years ago
Use square ABCD for this problem<br><br> IF AC=26,find BC.
katen-ka-za [31]

Answer:

x=\sqrt{338}

Step-by-step explanation:

a^2+b^2=c^2

x^2+x^2=26^2

2x^2=26^2

2x^2=676

/2           /2

x^2=338

\sqrt{x^2} =\sqrt{338}

x=\sqrt{338}

8 0
3 years ago
Read 2 more answers
Combine like terms: 3t + 5 (3 + t) - 2t - 4
antoniya [11.8K]
3t + 15 + 5t - 2t - 4
6t + 15 - 4
6t + 11
3 0
3 years ago
Read 2 more answers
Valeria's office recycled a total of 44 kilograms of paper over 4 weeks. How many weeks will it take Valeria's office to recycle
diamong [38]
The answer would be 6 weeks.

First, you do 44 divided by 4 to get 11 kg per week. Now you divide 66 by 11 to get 6 weeks.
8 0
3 years ago
PLEASE HELP ME FAST!!!
yawa3891 [41]

Answer:

ans -------8/5 pansnhshshsh

6 0
3 years ago
Read 2 more answers
Other questions:
  • the tangent to curve y = 2x / x - 1 which is not equal to1, at the point (2,4) and the normal to the same curve at the point (3,
    7·1 answer
  • Nate tells his mom that he took a test with 60 questions and scored 85%. How many questions did he answer correctly? Show how yo
    11·2 answers
  • -1/2 + (3/4times4/9)=
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Solve for r.<br> 7(r + 1) = 20.3
    5·2 answers
  • A model car is 6.9 centimeters long and 3.5 centimeters wide. find the real length of the car. Round your answer to the nearest
    11·1 answer
  • Anyone know the answer to this question
    6·1 answer
  • Carson invested $3,900 in an account paying an interest rate of 2.1% compounded
    9·1 answer
  • So I need 20 words but I don’t get why so here’s this useless sentence
    15·2 answers
  • What is the slope of a line parallel to slope 2 and Perpendicular to slope 2?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!