1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
13

Inside a non-dividing nucleus, you will see a mass of tangled DNA and protein called

Biology
1 answer:
nata0808 [166]3 years ago
6 0

Answer:

Chromatin

Explanation:

Chromatin means<em> "chroma"</em> in Greek. It can be found in <em>eukaryotic cells</em> with <u>non-dividing nucleus</u>. They make up the<u> chromosomes of cells</u> during <em>cell division. </em>The fibers of chromatin consists of DNA<em> (deoxyribonucleic acid</em>) and proteins<em> (histones and non-histones)</em>.

It is said that chromatins got their name owing to their<em> bright colors when mixed with dye</em>. This was found by scientists who inspected it under a microscope.

You might be interested in
What other factors might limit human population growth?
REY [17]

Answer:

joe biden

Explanation:

hes making people lose brain cells every time he talks/stutters

4 0
3 years ago
Which animal is an inverterbrate? <br><br>A.trout<br>B. cat <br>C. snake<br>D. termite​
Marianna [84]

Answer:

Termites

Explanation:

A termite is classified as an insect, and insects are inverterbrate.

7 0
3 years ago
Read 2 more answers
JOCUL WUOSI SWOIIUM USLUN
insens350 [35]

Answer:

A. Time and space

Explanation:

A body is a particular amount of matter. it can be solid,liquid or gas. It can be described as existing in Time and space.

Brainllst please

7 0
3 years ago
What is creative electrical energy is converted to mechanical energy
hammer [34]

<em>Energy transformation</em>, also known as <em>energy conversion</em>, is the process of changing energy from one form to another. In physics, energy is a quantity that provides the capacity to perform work (Ex: Moving a heavy object from one place to another) On top of that, being convertible, according to the law of conservation of energy, energy is transferable to a different location or object, but it CANNOT be created or destroyed.

When it comes to transforming electrical energy to mechanical energy, A generator converts mechanical energy into electrical energy, while a motor does the opposite. A motor converts electrical energy into mechanical energy. Both devices work because of electromagnetic induction, which is when a voltage is induced by a changing magnetic field.

P.S - After doing some searching, I have found something that should help you, if what I said is confusing or not helpful to you at all. This website has helped me on many occasions and is a very helpful and valuable tool.

                              ↓

                https://study.com/academy/lesson/electric-motors-generators-converting-between-electrical-and-chemical-energy.html      

<em>Select: Highlight by dragging cursor across the URL</em>

<em>Copy: Ctrl + C</em>

<em>Paste: Ctrl + V</em>

4 0
4 years ago
Discuss the role played by transcription during replication. ​
aleksandrvk [35]

Answer:

Explanation:

Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). DNA safely and stably stores genetic material in the nuclei of cells as a reference, or template. Meanwhile, mRNA is comparable to a copy from a reference book because it carries the same information as DNA but is not used for long-term storage and can freely exit the nucleus. Although the mRNA contains the same information, it is not an identical copy of the DNA segment, because its sequence is complementary to the DNA template.

7 0
2 years ago
Other questions:
  • A group of biology students tests the growth of bacteria under different conditions. The students apply the same amount of bacte
    10·2 answers
  • Anthony still insists that he needs an antibiotic to treat his viral infection. explain to him why an antibiotic will not help h
    9·1 answer
  • What happens when an active cold front over takes a warm front
    8·2 answers
  • Based on what you learned in pbs, what are three foods that would be considered good energy sources? explain your choices.
    15·1 answer
  • Sensory receptors that are located in the skin and sense touch, pain, heat, and cold are called: Answer
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What common animal has a major role in the discovery that genes are carried on chromosomes?​
    13·1 answer
  • What are some of the ways technologies invented for war can be repurposed for agricultural use?
    8·2 answers
  • An air mass that originates over land in Central America is most likely
    15·2 answers
  • Multicellular organisms are made up of many different levels of organization. Put these terms in order from the least complex to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!