1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Triss [41]
3 years ago
12

Un bioquímico para preparar una solución disuelve 50 gramos de droga en 150 gramos de agua. Calcular:

Chemistry
1 answer:
aleksandrvk [35]3 years ago
5 0

Answer:b

Explanation:

You might be interested in
Which element probably reacts most like bromine, Br?
Nikitich [7]
D) Chlorine, Cl. Hope that helped
8 0
3 years ago
Read 2 more answers
Help please thank you
Vikki [24]

Answer:

B I think I am pretty sure

8 0
3 years ago
The atomic mass is equal to what?​
dsp73

Answer:

The mass number

Explanation:

I hope this helps.

4 0
3 years ago
Read 2 more answers
Que es el dimorfismo sexual
a_sh-v [17]
??????????????????bbhhhbb
6 0
3 years ago
Plz HELP I NEED THIS NOW!!!!!!!!!<br><br><br> What landscape region is Long Island located on?
Kobotan [32]

The landscape region  of Long Island is the Atlantic coastal plain.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Compare and contrast chemical change and physical change.
    6·1 answer
  • Which statement describe compound​
    7·1 answer
  • What is the noble-gas electron configuration for bromine?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 5. The prefox Semi-Deans Capardy SC Based on your knowledge of the properties of elements, which kind of elements is most likely
    6·1 answer
  • When seeds germinate, roots grow downward and stems grow upward in response to gravity. This response to gravity is called _____
    5·1 answer
  • Gold(ill) hydroxide is used in medicine, porcelain making, and gold plating. It is quite insoluble in aqueous solution. Which of
    6·1 answer
  • 'if 100 grams of pure water taken from different sources is decomposed by passing electricity,11grams of hydrogen and 89 grams o
    11·1 answer
  • Explain how you can determine from the periodic table exactly how many neutrons are in an atom?
    14·1 answer
  • Is copper sulphate malleable?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!