1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
14

When an animal exhales, it releases carbon into the atmosphere. What is another way in which an animal is part of the carbon

Biology
1 answer:
sveticcg [70]3 years ago
6 0

Answer:

Passing carbon from one organism to the next

When an animal eats a plant, carbon from the plant becomes part of the fats and proteins in the animal. Decomposers and some animals, called detrivores , feed on waste material from animals, and the remains of dead animals and plants.

Explanation:

You might be interested in
Please help !!!!!!!!!
algol13
The biosphere. This is the layer that contains all life on the planet.
3 0
3 years ago
Read 2 more answers
Which of the following best explains why ecosystems need a continual influx of new energy?
Viktor [21]
Energy flows through an ecosystem and cannot be recycled. 
8 0
3 years ago
13. Small streams and rivers that flow into larger ones are called
Elodia [21]

Answer:

B

Explanation:

lol

6 0
3 years ago
Read 2 more answers
9.
svetoff [14.1K]

Answer:

The body parts are arranged like spokes on a wheel

Explanation:

Bilateral symmetry is when it is as two halves. And the other two options are not types of symmetries.

3 0
3 years ago
Which of these BEST
saul85 [17]
One strand runs in the 5 to 3 and the other in the 3 to 5
4 0
2 years ago
Other questions:
  • Which species in the United States are protected under the Endangered Species Act?
    13·2 answers
  • What three adaptations were needed for chordates to move from living in water to living on land?
    7·1 answer
  • Are hummingbirds attracted to the color red?
    15·2 answers
  • 2. Laertes is known to be wild child.<br> O<br> O<br> True<br> False
    6·1 answer
  • Which of the following locations would have the finest sedimentary particles?
    8·1 answer
  • During photosynthesis,
    14·2 answers
  • Cooking improves the taste of food and makes it easy to digest . Are any nutrients lost .Explain
    8·1 answer
  • Plz help
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • PLEASE PLEASE PLEASE HELP!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!