Answer:
b. Extraction with a solution of sodium hydrogen carbonate, separating the layers, followed by drying and evaporating the organic layer.
Step-by-step explanation:
The ether solution contains your product, benzaldehyde, and some starting material, benzoic acid, the purification steps are:
- Extract with a solution of NaHCO₃. The ether layer contains benzaldehyde, and the aqueous layer contains sodium benzoate.
- Separate the layers. Keep the ether layer.
- Dry the ether solution.
- Distill the ether (boiling point 35 °C) and purify the benzaldehyde (178 °C) by steam distillation.
a. is wrong. Extraction with HCl will not remove much of the benzoic acid.
c. is wrong. If you evaporate the organic layer, you will have a mixture of benzaldehyde and benzoic acid.
d. is wrong. If you work with the aqueous layer, you will end up with benzoic acid,
Cesium.
Groups are the vertical columns that run up and down while periods are the horizontal rows. So to find the answer to this, go to the first column (Group 1) and find the sixth period (row 6) which will land you on Cesium, element 55.
Hope this helps!
I'm only in middle school but i believe its coal.
The reaction is:
Cl2 + 2 KBr --> 2 KCl + Br2
Moles of KCl is
n = m /M = 12 /74 = 0.16 mol
As, twice the moles of KCl is producing from 1 mol of chlorine
mole of Cl2 = 0.16 /2 = 0.08 mol
Mass of Cl2
m /70 = 0.08 = 5.6 g
Hence, 5.6 g mol Cl2 consumed to produce KCl
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
