Answer:
After the water soluble hormone approaches its target, the last thing that happens in change in cell activity and the hormones send a signal/message to the original hormone.
Explanation:
Water soluble hormones easily attach themselves to the cell. These water soluble hormones are made up of amino acid. Amino acid are basically proteins which are easily soluble in water.
These water soluble hormones cannot enter the cell membrane of the cell because they are made up of fat cells.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The polysaccharide is the compound that is unlike wax, saturated fat, and the phospholipid. An example of a polysaccharide is starch.
As for this question of true or false, the most probable answer and the most likely answer for this would be true.
Nuts and grains are considered to be dry fruits. What people usually think when the word fruits come into mind is usually the ones that are fleshy and juicy and the seeds are inside. Well, for nuts and grains, the seeds are also inside but what we eat are the seeds itself. Though they may be referred interchangeably in everyday conversations, it is understood that nuts and grains are both fruits.
I think it’s A, I might be wrong tho..
