Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Cells organized into tissues
Explanation:
cells in complex multicellular organisms like people are organized into tissues, groups of similar cells that work together on a specific task
Answer:
<em>The correct option is b) the uses an area of land can be put to
</em>
Explanation:
Zoning laws can be described as guidelines which characterize how any municipal area should be divided. Zoning laws are laws which are to be followed to make zones in an area. For example, the making of residential or industrial zones. The type of land or zone determines whether permission should be given to develop the zone or not. Zoning laws determine which area should be ideal to construct what buildings and how a particular zone should be utilized.
