1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
3 years ago
12

In Georgia, there are two days during the year when the length of daylight is the same, 12 hours. These two days occur during __

______
A. Winter and Summer
B. June and July
C. Fall and Spring
D. The hottest part of the year
Biology
1 answer:
pashok25 [27]3 years ago
4 0

Answer:

(Equinox) fall and spring

Explanation:

Saturday March 20 and September 23

You might be interested in
Which statements accurately describe mass? Check all that apply. Mass is a chemical property of an object. Mass is measured usin
Pie

Kilograms are units of mass

The mass of an object remains constant

Mass is measured using balance


These are the correct answers, I hope it helps

5 0
3 years ago
Read 2 more answers
Which climate condition is typically found in the tropics due to the interaction of the atmosphere and hydrosphere?
ivolga24 [154]

Answer:

Option (C) is correct i. e. , wet with high humidity.

#$# THANK YOU #$#

5 0
4 years ago
The portion of the large intestine found between the transverse and sigmoid colon on the left side of the abdominal cavity is th
GuDViN [60]

Descending colon is found between the transverse and sigmoid colon on the left side of the abdominal cavity.

<h3>What are the components of large intestine?</h3>

The cecum, colon, rectum, and anus are the components of the large intestine. Mesenteries are tissue folds that hold the colon and rectum in the belly.

Caecum: The colon and ileum (the last part of the small intestine) are connected by a pouch-like channel called the cecum.

Colon: The longest part of the large intestine is the colon. There are 4 sections in the colon-

  • Ascending colon: The colon begins with the ascending colon. It is located on the abdomen's right side. It continues upward until it reaches the hepatic flexure, a bend in the colon.
  • Transverse colon: Following the ascending colon and hepatic flexure is the transverse colon. The upper portion of the abdomen is where it is located. The splenic flexure, a bend in the colon, marks its conclusion.
  • Descending colon: The transverse colon and splenic flexure are followed by the descending colon. The abdomen's left side is where it is located.
  • Sigmoid colon: The colon's final section, the sigmoid colon, joins to the rectum.

Rectum: The lower portion of the large intestine that joins the sigmoid colon is known as the rectum. Its length is roughly 15 cm (6 in). It takes waste from the colon and keeps it there until the anus allows it to leave the body.

Anus: The aperture at the bottom end of the rectum known as the anus is where feces exits the body.

Learn more about large intestine here:

brainly.com/question/1751875

#SPJ4

6 0
2 years ago
A cell of an organism has four chromosomes. It undergoes a process at the end of which two daughter cells are produced. Each dau
vlabodo [156]
Mitosis
because the cell split into two identical copies!
6 0
3 years ago
Read 2 more answers
Which statement describes how enzymes and substrates are related? The enzyme influences the speed of change from substrate to pr
azamat

Correct answer: A). The enzyme influences the speed of change from substrate to product

The enzymes are the biological catalyst that speed up the rate of chemical reactions by decreasing the activation energy of the reaction pathway.

They increase the speed of change of substrate to the product and it remains unchanged in the reaction. Hence, it can be used again and again.

Enzymes are highly specific in nature, only a specific substrate binds to the enzyme's active site. Hence, a particular enzyme is required to catalyze a reaction.






3 0
3 years ago
Read 2 more answers
Other questions:
  • _2. Second stage of the cell cycle when DNA is copied
    13·2 answers
  • The heat transferred to the ice increases the thermal energy of the molecules of water. Why does this cause a change in state?
    14·1 answer
  • Why is it unusual that lichens are classified as a species
    14·1 answer
  • Something that is constant in biochemistry
    11·1 answer
  • What is the concept of algae?​
    14·1 answer
  • Cómo podría tu familia y tú manifestar su participación democrática en la sociedad y el
    6·1 answer
  • Carbon dioxide. We read about the excess of carbon dioxide in the atmosphere and now it may be influencing our climate. But the
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Why was Fisher skeptical of Mendel's data?
    8·1 answer
  • Which best describe cancer cells
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!