Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Such unequal distribution of resources was commonly related to land for agriculture, necessary for population growth.
Answer:
Starch
Explanation:
Any member of a class of enzymes that catalyze the hydrolysis (splitting of a compound by addition of a water molecule) of starch into smaller carbohydrate molecules such as maltose (a molecule composed of two glucose molecules).
An organism must has a large surface area to volume ratio in order to exchange material easier
in animals erythrocytes have a flat concave shape that allows them to carry more haemoglobin and also increases its surface area to volume ration so that the length and availability of a surface is less for the materials to travel
multi cellular organisms tend to have flat and elongated respiratory surfaces to allow for a higher surface area to volume ratio in order to increase the rate of gas exchange
the ilium in most mammals is flat and elongated and is covered with microvilli to increase surface area and to reduce the cells volume therefore reducing its surface area to volume ratio
hope that helps
Answer:
probability = 0
Explanation:
The probability of having a phenotypically normal child is = 0
This is because since the Paul has Vitiligo and the vitiligo ( allele ) is a dominant allele and hence the allele will be passed onto the Child ruling out the chance of the couple having a phenotypically normal child
