Answer:
The correct option is A) will make no difference in the survival of life if there were major changes in the environment.
Explanation:
Due to genetic diversity, variations in species are caused which makes some organisms of a species to be better adapted than other members of the species. These variations cause organisms to survive when differences in the environment occur. Although the allele frequencies might change due to the changes in the environment but the phenomenon of genetic diversity allows life to sustain on earth even when conditions will become unfavourable.
Answer: Ascorbase a form of ascorbate, a drug used in the treatment of type 2 diabetes which acts to inhibit maltase a membrane bound enzyme that completes the digestion of starch in the human body.this inhibition is done through;
- By preventing substrates from binding to the active site therefore forming few enzyme complex substrates.
- it also inhibits the enzymes by binding to the active sites of that enzyme.
- it also does so by reacting slowly and also because it has a complementary shape to the active site of the enzyme maltase.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
a nucleus of Deuterium (2H)
Explanation:
formed from two protons with the emission of an antielectron and a neutrino. In the basic Hydrogen fusion cycle, four Hydrogen nuclei (protons) come together to make a Helium nucleus.
Answer:
Well the model above is showing all the planets in order from how close or far away they are from the sun and it also seems to show the scale of each planet compared to another.
Explanation:
As for the Evidence or why it is important to know this is because the scale and location of the planet to the sun directly effects everything about the planet, its Atmosphere, tempterue and rotaion. And the more we learn about all plants we can better underatand our own geological past behavior of its Atmostohere and futute clamatic trends.
