Answer:
A DNA fragment with sticky end sequence TGGCA will bind with another DNA fragment with sticky end sequence ACCGT.
Explanation:
When a DNA strand is separated by the restriction endonuclease, it forms two separate single strands. These strands or cuts are known as sticky ends as they are detached from the complementary pairs.
These cuts of DNA are without complementary pairs and when they find suitable base pair, they get attached to it. These sticky ends are allowed to fix with the complementary base pairs during PCR/ polymerase chain reaction.
They are called sticky ends as they are ready to stick with the complementary base pairs of nucleotides.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
The body can still get glucose from food, but the glucose can't get into the cells, where it's needed, and glucose stays in the blood. This makes the blood sugar level very high. ... When this happens, it may no longer be able to produce enough insulin to keep blood sugar levels where they should be.
