1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
12

Can someone please help?

Biology
1 answer:
Vedmedyk [2.9K]3 years ago
3 0

Answer:sorry

Explanation:sorry

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Water with dissolved soil in it percolating through a rock is an explane of what? ( weathering, erosion, or deposition)
frosja888 [35]

I'm pretty sure it's deposition because the sediments in the water(soil) are building up on the rock.

5 0
3 years ago
A model of an atom is shown below. Which element does this atom represent?
san4es73 [151]

Answer:

You didn't upload the model, so we cannot answer this question.

Explanation:

5 0
4 years ago
How do organelles contribute to efficiency in eukaryotic cells
Mazyrski [523]
The two groups differ in the composition of the cell wall and the lipids in the cell membrane. 3. ... Organelles contribute to efficiency in eukaryotic cells because they concentrate the biochemicals needed for chemical reactions so that the reactions proceed more rapidly.
6 0
3 years ago
Photosynthesis involves the transformation of light energy into what molecule
Andrej [43]

Answer:

Sugars

Photosynthesis is the process in which light energy is converted to chemical energy in the form of sugars. In a process driven by light energy, glucose molecules (or other sugars) are constructed from water and carbon dioxide, and oxygen is released as a byproduct

Explanation:

3 0
3 years ago
Other questions:
  • Blood stasis, changes in the vessel wall, and certain medications affect the: Select one: a. systolic blood pressure exclusively
    7·1 answer
  • Based on your knowledge of our solar<br> system, how do you think it originally<br> formed?
    14·1 answer
  • The atmosphere is 80% nitrogen: why do you think plants and animals can't use nitrogen as it is found in the atmosphere?
    10·2 answers
  • What would you expect to see in a blood sample of a person who has drowned in salt water? explain in terms of osmosis?
    12·2 answers
  • Scientists classify organisms into groups, usually with a dichotomous key. Using a dichotomous key is like solving a puzzle, one
    9·2 answers
  • Which two continents fit together best
    9·1 answer
  • Many animals form complex societies of related individuals. Which of the following benefits do these societies provide?
    8·1 answer
  • In pea plants, purple flower color, C, is dominant to white flower color, c. The table shows the frequencies of the dominant and
    15·1 answer
  • What four major divisions make up the history of life on earth in the geologic time scale
    10·1 answer
  • An example of mitosis at work is a plant root
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!