1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
9

Can someone help? Will mark Brainliest

Mathematics
2 answers:
jarptica [38.1K]3 years ago
8 0

Answer: The answer is the 3rd one

Step-by-step explanation:

VARVARA [1.3K]3 years ago
6 0

9514 1404 393

Answer:

  (d)  AE = (32√6)/3

Step-by-step explanation:

The side length ratios in a 30-60-90 triangle are 1 : √3 : 2. In a 45-45-90 triangle, they are 1 : 1 : √2.

So, we have the side length ratios ...

  CE : CD = 2 : √3

  BE : CE = √2 : 1

  AE : BE = 2 : √3

Then the ratio AE : CE is ...

  \dfrac{AE}{CD}=\dfrac{2}{\sqrt{3}}\cdot\dfrac{\sqrt{2}}{1}\cdot\dfrac{2}{\sqrt{3}}=\dfrac{4\sqrt{2}}{3}

Multiplying by the length of CD, we have ...

  AE = (8√3)(4√2)/3

  AE = (32√6)/3 . . . . . matches the last choice

You might be interested in
(NEED HELP WILL MARK BRAINLIEST)
Monica [59]

Answer:

D

Step-by-step explanation:

3 0
3 years ago
Read 2 more answers
A particular shade of paint is made by mixing 5 parts red paint and 7 parts blue paint. To make this shade, Shannon mixed 12 qua
SSSSS [86.1K]

<u>Answer:</u>

No, Shannon  didn’t mix the correct shade

<u>Explanation: </u>

Ratio required for the shade Red : Blue = 5 : 7

The ratio formed of Shannon must be equal to the above standard ratio

But Shannon’s ratio which was mixed for red and blue is

= Red : Blue  

= 8 : 12

= 2 : 3, which is not equal to 5 : 7.

Therefore it is proved that Shannon mixing does not matches with the required mixing ratio which is 5:7.

6 0
3 years ago
The area of a squared lawn and rectangular vegetable garden are equal.The perimeter of lawn is 24 m and its side is twice the br
rjkz [21]

Answer:

g=12

Step-by-step explanation:

4(2y)=24

8y=24

y =  \frac{24}{8}

y=3

{4y}^{2}  = yg

Since we know the value of y we substitude

{4 \times 3}^{2}  = 3g

36=3g

g=12

6 0
2 years ago
To become a member of the book-of-the-month club there is a $40 sign-up fee and a $2 monthly fee. What is the total cost of bein
bija089 [108]
$40 sign up + ($2 monthly fee x 19)
$40 + $38
=$78
3 0
1 year ago
Please help! Will give brainliest to correct answer! (1/3) - 50 POINTS - please no wrong answers.
astraxan [27]

Answer:

( 6, pi/6)

Step-by-step explanation:

( 3 sqrt(3), 3)

To get r we use x^2 + y ^2 = r^2

( 3 sqrt(3) )^2 + 3^2 = r^2

9 *3 +9 = r^2

27+9 = r^2

36 = r^2

Taking the square root of each side

sqrt(36) = sqrt(r^2)

6 =r

Now we need to find theta

tan theta = y/x

tan theta = 3 / 3 sqrt(3)

tan theta = 1/ sqrt(3)

Taking the inverse tan of each side

tan ^-1 ( tan theta) = tan ^ -1 ( 1/ sqrt(3))

theta = pi /6

7 0
2 years ago
Read 2 more answers
Other questions:
  • In similar triangles, corresponding angles are congruent.t or f
    8·1 answer
  • How many college basketball games in a season?
    13·1 answer
  • Find the slope of the line whose equation is 8y = 2x 4.
    6·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the missing numbers. What's the rule?
    14·2 answers
  • How many edges are there?<br> A. not enough information<br> B. 15<br> C. 7<br> D. 10
    6·1 answer
  • Find the solution set of the inequality: 8x+2 &gt; 348x+2&gt;34
    6·2 answers
  • A skydiver falls 125 feet in 5 seconds. How far does the skydiver fall per second?
    14·2 answers
  • Which Scentence is true about an obtuse triangle?
    15·1 answer
  • Select all the expressions that are equivalent to 40% of 90. A. 72 B. 36 C. 4/5x9. D. 40/100 divided by 90. E. 2/5x90
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!