1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
14

What is the space called in a cell that holds water

Biology
2 answers:
MrMuchimi3 years ago
5 0

Answer:

Central vacuole.

Explanation:

A central vacuole is an organelle that is full of water. This vacuole is bounded by a single membrane and functions as a combination of reservoir, waste dump, storage region, and keeps the cell in shape.

gregori [183]3 years ago
4 0

central vacuole  

bhubyigty

You might be interested in
What is the best definition of a conclusion
Anna11 [10]

Explanation:

the word conclusion means the end of a thought, in writing. You must summarize your thoughts or discovery and then add a conclusion to end a report.

6 0
3 years ago
In prokaryotes, the rigid layer of material outside the plasma membrane is a _________.
Anettt [7]
Cell wall. 
Hope this helps!
pls give Brainliest answer!
8 0
3 years ago
Drip irrigation can reduce the amount of water used on a farm. <br><br> True <br><br> False
Sergio039 [100]
Its True beacause using a regular irragation system wastes much more water than a drip irrigation system
7 0
3 years ago
Read 2 more answers
Gender stratification refers to the ranking of males and females according to their access to power, property, and prestige base
Natalka [10]

Gender stratification refers to the ranking of males and females according to their access to power, property, and prestige based on their sex. false

3 0
3 years ago
Which safety practice should always be done at the beginning and the end of a microbiology lab
Rufina [12.5K]

Answer:

<em>Hand Washing</em> is one of the most important practices when it comes to avoid spreading germs due it helps removing microorganisms and potential pathogens that could be left on after regular activities which would alter the results of lab experiments, and also could easily remain after such lab experiments which could lead to the propagation of bacteria or harmful chemicals.

Explanation:

6 0
3 years ago
Other questions:
  • A mountain can affect climate by a. absorbing more solar energy at the peak than at the base of the mountain. b. causing precipi
    15·1 answer
  • Amenorrhea may occur among women at fat levels as high as:
    12·1 answer
  • Which is an autonomic body function? squinting in the sunlight salivating at the thought of a hamburger raising your hand in cla
    9·2 answers
  • Breaking away of the cell membrane from the cell wall in a plant cell as water leaves the inside of the cell?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is not true regarding carbohydrate structure and function?
    10·1 answer
  • Where did the Parliament offer leadership to assert its authority during the Glorious Revolution of 1688?
    9·2 answers
  • What are stem cells?
    12·1 answer
  • .
    9·2 answers
  • Where does blood go after it leaves the right ventricle.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!