1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
3 years ago
10

PLS HELP OR ILL FAIL SCHOOLill give brainliest and help you with wtv

Biology
2 answers:
kiruha [24]3 years ago
7 0

Answer:

13. shared derived characteristic

14. Hagfish

15. No, it doesn't have jaws.

16. Mammary glands.

17. Jaws and lungs.

18. Lizard, bird, cow, lion.

19. the frog

20. Claws/nails, lungs, and jaws.

Explanation:

Sveta_85 [38]3 years ago
4 0

Answer:

I'm not sure about 13 and 19.

13. Traits?

14. Hagfish

15. No, it doesn't have jaws.

16. Mammary glands.

17. Jaws and lungs.

18. Lizard, bird, cow, lion.

19. The bird?

20. Claws/nails, lungs, and jaws.

Also, this is a cladogram, in case you needed the info. :)

You might be interested in
Help with does 2!!!!!!!!!!!!!!!
julsineya [31]

Answer:

5)a,d,b

6)c,d,a

I think

3 0
3 years ago
Read 2 more answers
Botox is often administered in extremely diluted form for a number of medical conditions and to reduce facial lines. It is one o
Burka [1]

Answer:

it is a neurotoxic protein

Explanation:

It effects how the brain carries out daily essential life functions and hinders the medulla oblongata after long enough exposure. Also causes partial paralysis

4 0
4 years ago
Compare between photosynthesis and chemosynthesis<br> Helppppp
xxMikexx [17]

Answer:

Photosynthesis and chemosynthesis are both processes by which organisms produce food; photosynthesis is powered by sunlight while chemosynthesis runs on chemical energy.

Explanation:

hope it helps

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
In a comparison of birds and mammals, the condition of having four limbs is.
Serga [27]

Answer:

In a comparison of birds and mammals, the condition of having four limbs is a shared ancestral character

8 0
3 years ago
Other questions:
  • Two species of meadowlark have different mating calls that lead to reproductive isolation. What type of isolation does this exam
    14·2 answers
  • Why does the oxygen atom in a water molecule have negative charge?
    15·2 answers
  • We can divide natural resources into two basic categories: renewable and nonrenewable. Consider the bar graph of resource usage.
    15·2 answers
  • Explain why the rate of cell division differs among different somatic cells.
    7·1 answer
  • What is the one part of the nucleotide that differs among the other different nucleotides?
    15·2 answers
  • 1. What is the host for parasitoids wasps?
    10·1 answer
  • Embryology is the study of the development of an
    5·2 answers
  • Explain the relationship between crossing over<br> and genetic variation.
    5·1 answer
  • Which is NOT one of the three main categories of adaptations?
    12·1 answer
  • 1. What is the role of the cell membrane in cell division
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!