1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
6

Alicia is being tickled by her older sister. which divisions of the nervous system are receiving the signals from her sister’s f

ingers?
Biology
2 answers:
Finger [1]3 years ago
6 0

In this case, when Alicia is being tickled  by her older sister, the divisions of the nervous system which are responsible for receiving the signals from her sister’s fingers are called somatosensory cortex and anterior cingulated cortex nervous system. 

When you are touched lightly, the effect of having that ticklish sensation is caused by the analysis of two regions of the brain. For example, when our brain analyses the pressure of the touch, this is the work of the somatosensory cortex. On the other hand, as soon as something touches your skin, the signal sent from the skin's sensory receptors also passes through the anterior cingulated cortex.<span>This is where the pleasant feelings are governed. </span>

bezimeni [28]3 years ago
3 0

Answer:

The correct answer is central nervous system and peripheral nervous system.

Explanation:

The sensation of tickle stimulates the nerve terminals, the touch receptors in the skin are the constituents of the PNS. The sensation information is then transmitted via the nerve fibers to the CNS, the brain, and the spinal cord.  

The assessment of information is then done in the somatosensory area of the brain, that is, in the cingulate cortex and the cerebral cortex. Thus, both the divisions of the nervous system, that is, the CNS and the PNS takes part in the process of tickling sensation.  

You might be interested in
during a science fair a group of students came up with the following colon is color an inherent property in objects or is it a p
olya-2409 [2.1K]
<span>A. Color is not an observable phenomenon.</span><span> 
B. It does not attempt to explain the natural world.</span><span> 
C. The experimental group would be too large.</span><span> 
D. How people experience color varies.


I think it would be B or D, you can analyze them both and I'm sure you'll come up with an answer ;)</span>
6 0
3 years ago
Read 2 more answers
If a user performs a query that restricts the rows returned based upon a specified date, the date must be enclosed in ____.
s344n2d4d5 [400]
The answer should be <span>single quotation marks</span>
6 0
3 years ago
Which of the following is an example of wind
stiks02 [169]

Answer:

I'm pretty sure the answer is B! Hope this helps:]

6 0
3 years ago
Sandra is heterozygous for eye shape.
amid [387]

Awnser:

She has two different alleles for eye shape, one from each parent

You always receive 1 allele from each parent, and you're heterozygous, those alleles are different.

6 0
3 years ago
Read 2 more answers
PLEASE HELP ASAP!
Fudgin [204]
B) Geothermal energy requires a lot of fuel once the plant is operating

It's a power plant, it should be self-sufficient.

I hope this works =^)
6 0
3 years ago
Other questions:
  • Flying insects typically _____. decrease metabolism as much as 200-fold during flight switch from diffusion of tracheal gases to
    10·1 answer
  • An example of a hybrid species that is is breed for greater strength?
    9·1 answer
  • What is a population?
    15·2 answers
  • When a non-enveloped animal virus adsorbs to the host cell with its protein spikes, the virions are taken into the cell by the p
    9·1 answer
  • Which of the following is the actual event that translates the language of nucleic acids (the sequence of bases, A, T (U), C, an
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A 79 year-old male resident of a long term care facility has contracted clostridium difficile and is experiencing consequent dia
    13·1 answer
  • THE FIRST PERSON TO ANSWER ASAP
    6·2 answers
  • Which of the following is not a phenotype?
    14·1 answer
  • Can some on please help me with this assignment
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!