1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
6

Drag and drop the steps of digestion to order them from first to last step.

Biology
1 answer:
Fynjy0 [20]3 years ago
7 0

Answer:

The teeth in the mouth bite off a piece of food.

The teeth continue to break the food into smaller pieces.

Saliva rushes into the mouth and mixes with the broken-down food.

The food travels down the esophagus.

The muscles of the stomach churn the food and continue to break it down.

The broken-down food, called chyme, enters the small intestine.

The remaining food passes into the large intestine. Water is absorbed from the large intestine and the rest of

the material is stored as solid waste until it is excreted from the body.

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The basic unit of all life for all organisms
Jobisdone [24]

Answer:

cells

Explanation:

7 0
4 years ago
Read 2 more answers
What happens when fluid is heated​
Crazy boy [7]

When heat is added to a substance, the molecules and atoms vibrate faster. Solids, liquids and gases all expand when heat is added. When heat leaves all substances, the molecules vibrate slower. The atoms can get closer which results in the matter contracting.
7 0
3 years ago
Which force is the central causative agent of the cohesion-tension model of xylem transport?
PilotLPTM [1.2K]
The causitive agent of the cohesion-tension model of xylem transport is transpiration. During the process of transpiration, water vapor is lost from the stomata of the leaf. To replace this water, water from adjacent cells is withdrawn. The water molecules stick together due to cohesion and are transported upwards through the stem in the form of a stream.<span />
4 0
3 years ago
which organelle contains digestive enzymes that break down waste material and the priests in the cell
Scrat [10]
The answers lysosomes, they digest enzymes that break down waste material and the priests in the cell. 
4 0
3 years ago
Other questions:
  • What percentage of babies are born with avs?
    10·1 answer
  • How do bacterial cells maintain their shape?
    6·1 answer
  • Does anyone know how asymmetric liposome works? asymmetric liposome
    11·1 answer
  • If you use soymilk on a regular basis, you should select a variety that's
    7·1 answer
  • What do all members of a biological species have in common?
    8·1 answer
  • I don’t understand how to do this, please help..
    5·1 answer
  • How does the formation of sea ice impact the density of the surrounding seawater?
    7·1 answer
  • Rainforests are not found in
    15·2 answers
  • Which type of mutation results when bases are added to a gene
    11·1 answer
  • Which activity can be accomplished using the genetic code?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!