1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvv77 [185]
3 years ago
11

Where does an avocado plant get carbon atoms to make proteins? *

Biology
2 answers:
Y_Kistochka [10]3 years ago
4 0
Kdkdkslslslsosoxosososowowowo air
wolverine [178]3 years ago
3 0

Answer:

i believe it is A: air because carbon comes from air so if they take in the air to maike it they are also taking in carbon

Explanation:

You might be interested in
Which constellation is home to the star forming nebula called the heart nebula?
miv72 [106K]
The milky way is your answer
5 0
3 years ago
The dinosaur pictured below has a blade-like nasal horn and two smaller horns in the lacrimals in front of the orbits. it also h
snow_lady [41]
Marginocephalia, ceratopsians - like the triceratops. These dinosaurs are usually depicted with two horns coming from the top of orbits and one from the top of the nose. They also present pointed teeth and a mouth with very prominent maxillary bones. These animals were <span>herbivorous and all these structures served that type of food.</span>
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
When testing tonicity of red blood cells, if the solution became transparent after adding blood cells, you could assume:.
sveticcg [70]

If the solution becomes transparent we could assume that ;  The solution was hypotonic and the cells had burst.

<h3>Tonicity of red blood cells </h3>

To test for Tonicity of red blood cells, we placed the cells in a solution.When red blood cells are placed in hypotonic solution there is high rate of osmosis in which the solvent flows into the red cells placed in the solution the cells will experience a process known as Hemolysis and these cells do not diffuse light, the solution becomes a red transparent solution.

Hence we can conclude that If the solution becomes transparent we could assume that ;  The solution was hypotonic and the cells had burst.

Learn more about Tonicity of red blood cells : brainly.com/question/6658551

4 0
2 years ago
What sedimentary rock is formed by evaporation of seawater?
Nataly [62]
The answer is halite i hope this helps
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes a difference between prokaryotic cells and eukaryotic cells?
    7·2 answers
  • Describe an environmental factor that could influence natural selection and decrease genetic diversity and pick a specific examp
    6·2 answers
  • Help me plzzzzzzzzzz i will mark brainliest!!!
    13·2 answers
  • A. True <br> b. False: decision structures are also known as selection structures.
    8·1 answer
  • Which of the following is an example of an abiotic factor
    13·2 answers
  • Iron deficiency anemia is the most common mineral deficiency. <br> a. True <br> b. False
    12·2 answers
  • Which of the following is NOT an example of an anaerobic exercise?
    10·2 answers
  • Rachel is using a Bunsen burner to heat a solution. Which of the following would let her control the rate of reaction in the sol
    5·1 answer
  • How humans changed the balance of the park ecosystem.
    7·1 answer
  • What is an anteaters competitors
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!