1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
13

1. How many dark moths did you capture? _______

Biology
2 answers:
kobusy [5.1K]3 years ago
6 0
The first two questions are for you to answer.

3) light moths
irga5000 [103]3 years ago
5 0

1 ) 7

2 ) 2

3 ) the light moth


You might be interested in
while observing an elodea plant cell through a microscope a student noticed a small moving greendisk these organelles are most l
Drupady [299]
Answer:  "photosynthesis" .
________________________________________________________
<u>Note</u>:  These small, moving "green disks" seen while observing an <em>Elodea</em> plant cell—under a microscrope— are "chloroplasts".   The "chloroplasts" are organelles that ar responsible for "photosynthesis" .
_________________________________________________________
6 0
3 years ago
where they execute important functions. The polypeptide chain of these proteins must cross the lipid bilayer. This presents a pr
spin [16.1K]

Answer:

In this case, it is likely that the polypeptide chain assumed an alpha helix configuration because the lipid bilayer did not have beta-barrel proteins.

Explanation:

A polypeptide chain is naturally polar, however, a lipid bilayer is naturally non-polar. This makes it difficult and even prevents the polypeptide chain from crossing a lipid bilayer, since the composition of these two elements does not allow them to mix. In that case, the polypeptide chain has two options to take to successfully cross the lipid bilayer.

The first option that the polypeptide chain has is to allow the creation of twisted beta sheets in the shape of a closed barrel in its structure. This only works if the lipid bilayer has beta barrel proteins in its composition to act as a transport channel for the polypeptide chain. However, few lipid layers have this protein.

Most likely, the polypeptide chain assumes an alpha helix conformation to cross lipid bilayers that do not have beta-barrel proteins. By assuming the beta conformation, the polypeptide chain reinforces the hydrogen bonds present in its composition, allowing it to cross the lipid bilayer without having its conformation and structure disassembled.

6 0
3 years ago
What are the three types of energy transfer that happen in the atmosphere of the earth? Mark all that apply.
Anastasy [175]
1. Conduction, convection, radiation

2. True

3. Absorbed, scattered, reflected, transmitted

4. Albedo, greenhouse effect
7 0
3 years ago
Read 2 more answers
How biodiversity is affected by speciation, disruptive, stabilizing, and directional selection?
VikaD [51]

There are several ways selection can affect population variation:

stabilizing selection

directional selection

diversifying selection

frequency-dependent selection

sexual selection

As natural selection influences the allele frequencies in a population, individuals can either become more or less genetically similar and the phenotypes displayed can become more similar or more disparate. In the end, natural selection cannot produce perfect organisms from scratch, it can only generate populations that are better adapted to survive and successfully reproduce in their environments through the aforementioned selections.


Hope it helped, much love

The jokester, hehe

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • we know that tiktaalik is more closely is more related to acanthostega than it iscanyhostega eusthenopteron because tiktaalik an
    9·1 answer
  • In a population of plants, the allele for long stems is completely dominant over the allele for short stems. If 35% of the popul
    15·1 answer
  • Which of the following statements is true?
    7·1 answer
  • Which of the following is true regarding extinction?
    9·2 answers
  • How is a molecule different from a compound? Are all molecules compounds?
    8·1 answer
  • Which statement describes the blood type of a person with the alleles IAIB?
    10·2 answers
  • Bill Barkley compares his checkbook register, cancelled checks, and bank statement which shows a balance of $500. He finds two o
    6·1 answer
  • Plz someone help me!!!!!!
    11·1 answer
  • What is the difference between insight and cultural behavior
    14·1 answer
  • Differences between sexual vs asexual reproduction
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!