1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bulgar [2K]
2 years ago
5

This is an animal with a backbone or a notochord.

Biology
1 answer:
lora16 [44]2 years ago
4 0

Answer:

Chordates share some common traits. At some point in their life cycle, they have a notochord, a nerve cord, and pharyngeal (fayr uhn JEE uhl) slits in the neck or throat. The notochord is a flexible rod that supports the animal's back. ... Sharks are one type of vertebrate animal that have backbones made of cartilage.

You might be interested in
Without doing a Punnett square, predict what percentages of
kupik [55]

Answer:

50% slipper footed, 50% non-slipper footed

8 0
2 years ago
Match each item to its description.
fenix001 [56]

Answer:

An explosion of a star= Supernova

The dense remains of a star= Neutron star

A large mass of gas and dust= Nebula

Explanation:

8 0
3 years ago
Read 2 more answers
The number of times per week that exercise is performed is known as ________. Intensity frequency regularity time
Kruka [31]

The number of times per week that exercise is performed is known as frequency.

Exercise frequency answers the question how many times you workout per week total. This includes weight training workouts, cardio workouts.This is value that can vary depends on many factors specific to individual (age, weight, condition). Because of this, it’s impossible to say exactly how often(how many times) everyone should be working out per week total.


3 0
2 years ago
The ultimate source of energy to support most life on Earth is _____. See Concept 10.1 (Page 189)
Afina-wow [57]
B) sunlight

Sunlight supports life by providing food and warmth which is needed for the population of practically anything on earth to survive
4 0
2 years ago
Read 2 more answers
Q25. A 68-year-old man was choking on a piece of steak at a family restaurant. Despite attempts to dislodge the food via abdomin
madreJ [45]

Answer:

The answer is C. Cricothyroid membrane

Hope this helps :)

Explanation:

4 0
2 years ago
Other questions:
  • Which organism in a food chain is probably responsible for keeping the food web and the pyramids in their respective shapes? Why
    12·1 answer
  • Replication origins have ________ DNA sequences that attract _______ proteins. A. A-T rich; histone B. G-C rich; Helicase C. A-T
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The cell division process that produces daughter cells with half the chromosome of the parent cell is _________.
    11·1 answer
  • Extensions from megakaryocytes that extend through blood vessel walls in red marrow are sliced off from the cells by the force o
    15·1 answer
  • If, on average, 46% of the loci in a species' gene pool are heterozygous, then the average homozygosity of the species should be
    11·1 answer
  • Nut is to _______ as pea is to pod.
    9·2 answers
  • Which type of plant makes up the largest group in the Plantae kingdom?
    8·1 answer
  • HELP DUE IN 5 MINS
    12·1 answer
  • 2. What substances travel in the Xylem of flowering plants?<br>​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!