1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
3 years ago
6

Where does glycolysis take place? Krebs cycle? ETC? Be specific

Biology
1 answer:
STALIN [3.7K]3 years ago
3 0

Answer:

pleb is the dam answer loser

You might be interested in
Mass of an orange<br><br> A.Meter<br> B.Liter <br> C.Kelvin<br> D.Kilograms
fgiga [73]
The answer is d.kilograms
8 0
3 years ago
Read 2 more answers
Which of these body systems has cells that attach to each other to form a leak-proof barrier?
hodyreva [135]
I would say urinary system due to it containing fluid. But I also want to say endocrine so between them both
8 0
3 years ago
What is the function of nitrogen-
Effectus [21]
I think the answer is C
8 0
4 years ago
Susan tells Jacob that the flour jar is in the cupboard under the sink. Which among the vital functions of human language is bei
Kay [80]
Might just be D must of them don't seem right to me
4 0
3 years ago
Read 2 more answers
Please what is the specific name for yam
maw [93]

Answer:

dioscorea alata is specific name of yam

5 0
3 years ago
Other questions:
  • Which hormone is used in testing for pregnancy?
    11·1 answer
  • true or false scientists must be careful not to use inductive reasoning because it can lead to faulty conclusions
    13·1 answer
  • Which element is carried by blood to all your body cells to provide them with the fuel they need to function
    5·1 answer
  • Are fatty acids lipids, if so why?
    13·1 answer
  • Which of these best describes what occurs during cytokinesis?
    5·2 answers
  • Describe 2 way cancer might arise from problems with the cell cycle
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Brainleist for answering #12 and #13
    9·1 answer
  • What event accompanies energy absorption by chlorophyll (or other pigment molecules) of the photosystems
    9·1 answer
  • Which is NOT a sign of a healthy plant?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!