1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
3 years ago
5

Please help if you can.

Biology
2 answers:
snow_lady [41]3 years ago
5 0
I think it’s 23 cm 12 in

Hope this helps
Maslowich3 years ago
4 0

Answer:

23cm and 12inch

Explanation:

You might be interested in
The rate velocity changes with time is called
Natali [406]
I guess it’s acceleration
3 0
3 years ago
What class of organic molecules does dna belong and what are the subunits of this class?
Nostrana [21]
<span>DNA, also known as deoxyribonucleic acid, belongs to a class of polymeric organic macromolecules called nucleic acids. The only other member of this class is ribonucleic acid, or RNA. Nucleic acids were first discovered in 1869 by the Swiss scientist Friedrich Miescher.
</span>
<span>DNA and RNA play important roles as genetic information carriers in biology, enabling the mechanisms of heredity and protein synthesis. Nucleic acids are polymers of nucleotides, which are composed of a five-carbon sugar, also called a pentose sugar, a nitrogenous base and a phosphate group. The sugar is deoxyribose, in the case of DNA, and ribose, in the case of RNA.</span>
3 0
3 years ago
Read 2 more answers
How does the immune system respond to a viral infection ?​
Genrish500 [490]
The white blood cells attack the infection
3 0
3 years ago
A new microorganism is isolated from a lake and is placed into a solution of KCl. The voltage difference across its membrane is
Leona [35]

Answer: \Delta U= 1.922x10⁻²⁰ Joules

Explanation: <u>Electric</u> <u>Potential</u> <u>Energy</u> (U) is the energy a charged object has due to its location in an electric field and it will only exist with the object is charged.

<u>Voltage</u> or <u>Electric</u> <u>Potential</u> <u>Difference</u> (V) is external work done to move a charge from one point to another in a electric field.

These terms have a relationship, which is given by:

\Delta U=q\Delta V

where

q is the charge

Proton is positive and has a charge of 1.6x10⁻¹⁹C.

Unit for potential energy is Joule (J). The relation between mV and J is

1mV = 10⁻³J

Then:

V = 120x10⁻³

V = 0.12

So, for a proton to move from the negative side of a membrane to the positive:

\Delta U=q\Delta V

\Delta U=1.6.10^{-19}.0.12

\Delta U = 1.922 x 10⁻²⁰

Energy necessary to transport a proton from negative side of the membrane to the positive is 1.922 x 10⁻²⁰J.

4 0
3 years ago
Please can someone pls help me out and tell me if this statement is true or false
san4es73 [151]

Answer:

False

Explanation:

the offspring would be 100% heterozygous

7 0
3 years ago
Read 2 more answers
Other questions:
  • PLZ HELP ITS TIMMEEDDD I DONT HAVE ALOT LEFT XC
    9·2 answers
  • The three most widely used psychoactive drugs in the world are
    15·2 answers
  • Place the following words into the illustration below: gametes, sporophyte, gametophyte, and zygote. Explain how the terms are r
    14·1 answer
  • Herbivores consume plants and use the nitrogen from plants to produce all of the following organic compounds except:
    7·1 answer
  • Which of the following is least likely to provide evidence of biological evolution?
    7·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • A species of plant produces purple or white flowers. The results of crossing a purple and a white flower and two white flowers a
    8·1 answer
  • A biologist found an asymmetrical organism. A part of the organism was injured, but it was able to repair itself through regener
    14·1 answer
  • Of the three states of matter -- solid, liquid, and gas -- which one exerts the highest pressure on its container, and why?
    14·1 answer
  • Chlorophyll
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!