A chimeric individual is one that has two sets of genetic makeup in their body. These individuals develop during the fertilization stage of growth and development. This occurs when two ova are each, separately, fertilized by a sperm. The two zygotes fuse, implant and begin to develop as one blastocyst. As the blastocyst develops and differentiate, some parts of the blastocyte are developed from the genetic material of one of the cell lines while other parts develop from the other cell line. Therefore, the fetus will have particular tissues and organs with different genotype from others.
The function to represent the number of cells present at the end of h hours if there are initially 4 of these cells is n= 4(2)ˣ
Given,
A particular type of cell doubles in number every hour.
So, to determine which function can be used to find the number of cells present at the end of h hours if there are initially 4 of these cells.
The number of cells denoted with n.
Therefore, the number of bacteria after every hour will form a geometric series.
<h3>
What is Geometric Progression?</h3>
Geometric Progression or geometric Sum of G.P. is refer to as if each term is a multiple of the next term then this sequence.
aₙ =arˣ
Where a is the first term which is 4.
And r is the common ratio r = 2.
Therefore,
The number of cells present at the end of h hours if there are initially 4 of these cells is,
n = arˣ
n = 4(2)ˣ
Hence, the function represents the number of cells present at the end of h hours if there are initially 4 of these cells is n = 4(2)ˣ.
For more details regarding cell division, visit:
brainly.com/question/4365207
#SPJ4
Consumers must obtain their nutrients and energy by eating other organisms. Decomposers break down animal remains and wastes to get energy.
Answer:
Small scale convergence
Explanation:
This term in meteorology occurs in a convergence zone; a region in the atmosphere where two air flows meet and interact, usually resulting in major weather conditions. A Small-scale convergence will produce situations ranging from isolated cumulus clouds to large areas of thunderstorms.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.