1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
10

Beneficios y perjuicios de una vacuna

Biology
1 answer:
Sloan [31]3 years ago
5 0

Answer:

Explanation:

Beneficios: desarrollar inmunidad,ayuda al sistema inmunológico a desarrollar la misma respuesta que una infección real, para que pueda desarrollar anticuerpos y combatirla en el futuro.La viruela se ha erradicado por completo gracias a las vacunas y la poliomielitis no se queda atrás. Las vacunas contra la polio todavía se administran para ayudar a mantener el control de la enfermedad hasta que se haya eliminado en todo el mundo.

Daño: síntomas de un resfriado o fiebre leve que muestra que su cuerpo está combatiendo la infección. Puede haber dolor en los músculos o enrojecimiento en el lugar de la inyección. Todos estos efectos secundarios muy leves desaparecen en un par de días, las alergias

NO TOME LA VACUNA

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Pls help, it’s 9th grade.
lara [203]

Answer:

its either C or D, im not sure bc im in 6th

Explanation:

8 0
3 years ago
Read 2 more answers
The two rectangles are similar. Which is the correct proportion for corresponding sides?
aliina [53]
The correct answer is B.
3 0
3 years ago
What word segment means “muscle”
Vinvika [58]
My(myo) may be is the right one
8 0
3 years ago
How does seed formation take place in plant? explain.​
neonofarm [45]

Answer:

Seeds are the result of plant reproduction. ... When pollen lands on the flower's stigma, it germinates and forms a pollen tube, which then quickly grows towards the plant's ovary. Once it finds an ovule, the pollen tube bursts to release sperm cells, which fertilize the ovule and initiate seed formation.

Explanation:

5 0
3 years ago
Other questions:
  • 13)
    10·1 answer
  • What emerging technologies will make chemical energy safer, more usable, more efficient, and cleaner?
    14·2 answers
  • A geologist is studying two different rhyolite flows to determine if they were erupted at the same time.
    10·1 answer
  • Why does the Moon have a greater influence on Earth's tides than the Sun does?
    5·2 answers
  • What is a change in the genetic code called?
    7·2 answers
  • HELP MEES! MEDALS!
    13·1 answer
  • Which group of organisms obtains energy by breaking down waste and dead organisms?
    8·2 answers
  • Why is this flower able to self-pollinate?
    14·1 answer
  • What can cause DNA to mutate?
    12·1 answer
  • where do photosynthetic organisms get the energy needed to make sugars during the light-independent/dark reactions?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!