1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
3 years ago
7

Yeast cells, plant cells, and mammal cells all share many similarities in cell signaling. This provides evidence that:________

Biology
1 answer:
alina1380 [7]3 years ago
3 0

Answer:

D

Explanation:

You might be interested in
if there is no oxygen during the cellular respiration process, the Krebs cycle does not occur. True or False
Veseljchak [2.6K]
The answer is gonna be false
7 0
3 years ago
Read 2 more answers
The tendency for a solution of water and solutes to take up water across a selectively permeable membrane is called
olasank [31]

Answer:

Osmosis.

Explanation:

Osmosis is defined as the passive transport in which net movement of water across the membrane from high water area potential to low water area potential. The membrane is known as selectively permeable membrane moved by a concentration of solute both sides of the membrane.

Selectively permeable membrane is a membrane which is selective in nature that allows unrestricted passage of water molecules, but not solute molecules.

5 0
3 years ago
PLEASE HELP QUICK!!!!!! WILL GIVE BRAINIEST!!!!!!
tatyana61 [14]
It’s the second one I believe:)
5 0
3 years ago
Proteins that tag pathogens for destruction by immune cells are called A. antibodies. B. antigens. C. histamines. D. interferons
kifflom [539]
Proteins that tag pathogens for destruction by immune cells are called Antigens.
5 0
3 years ago
Read 2 more answers
For humans, freckles are dominant over not having freckles. Which offspring would not have freckles?
Nadya [2.5K]

Answer:

Explanation:

The only way a recessive trait will show is if the offspring receives 2 recessive (lower case) alleles.

If there are any upper case letters present only the dominant trait will show.

The correct answer would be the box(es) that contain 2 lower case letters.

8 0
3 years ago
Other questions:
  • What is a trait that probably has a complex pattern of inheritance? Explain your response.
    14·1 answer
  • To what organ does the umbilical vein lead
    7·1 answer
  • A unique characteristic of mammals is that they _____. have hair have a four-chambered heart have both aquatic and terrestrial s
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • After completing 10 years of experimentation, a scientist reports a
    15·1 answer
  • In Photosynthesis and Cellular Respiration, GA3P and water are reactants for:
    8·2 answers
  • Saclike membranes that contain chlorophyll are known as
    11·2 answers
  • Why does DNA replicate itself?
    14·1 answer
  • 1. Submit your observations of the chicken leg dissection.
    7·1 answer
  • Ibuprofen is a drug commonly used to relve inflammation and pain, it is a mixture of two enatiomes whicha re moldules that:_____
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!