1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valkas [14]
3 years ago
7

1. Why is Carbon important?

Biology
1 answer:
Arturiano [62]3 years ago
7 0

this is correct answer oky

You might be interested in
10. are a type of producer found in aquatic environments. In a particular lake, the phytoplankton have begun to
RUDIKE [14]

Answer: I think that it would be C because blooms are due to eutrophication, which means that there are high levels of phosphate in the water. Phosphate is a main ingredient in pesticides, which can run-off into rivers.

8 0
3 years ago
You leamed that carbon is an important building block of organisms and that moves through organisms, between organisms, and the
Natasha2012 [34]

Answer:

1. Atmosphere and ecosystem

2. Carbon/CO2 is absorbed by the plants and then released as oxygen.

3. Carbon is used in the cellular respiration process to make ATP.

4. Decomposers break down dead material and release CO2 in that process into the atmosphere for plants to use that carbon for photosynthesis again.

3 0
3 years ago
QUICK PLEASE HELP PLEASE
Alex787 [66]
<span>For question 1: we know the vA=10.0 cm3 and the m=89.6g. Using the equation D = m/vA give us: D = 89.6/10 = 8.96 g/cm3. Answer is (C) 8.96 g / cm3. For question 2: We know the vA=1.2 cm3 and the D=.6 g/cm3. Using the equation D = m/vA and rearranging for m gives us m = D*vA: m = .6 * 1.2 = .72 g. Answer is (D) .72 g. For question 3: We know the D = 8 g/cm3 and the m = 600g. Using equation D = m/vA and rearranging for vA gives us vA = m / D: vA = 600 / 8 = 75 cm3. Answer is (A) 75 cm3.</span>
6 0
3 years ago
Read 2 more answers
The internal control of mechanisms allows for an organisms system to remain in balance
Natalka [10]
The term used to describe the organisms overall attempt at maintaining balance or equilibrium of it's internal environment is called Homeostasis. 
7 0
3 years ago
4. Does simple diffusion require an input of energy?
Sedbober [7]

Answer:

no

Explanation:

Simple diffusion does not require energy or need the assistance of a transport protein. Other larger or charged molecules that diffuse across a membrane may need assistance from a protein.

7 0
3 years ago
Other questions:
  • To which of the six crystal systems does a halite crystal( rock salt) belong?
    10·2 answers
  • is a protein found in blood that is represented by a + or – sign, which affects the compatibility of blood with other blood type
    5·2 answers
  • List any of the food samples that tested positive for more than one type of molecule. explain why it is an advantage for us to e
    14·1 answer
  • Which describes the correct order of the geologic time scale, from oldest to most recent?
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What body system produces movement
    13·1 answer
  • 6. Type of energy that can travel through space in the form of waves.​
    13·1 answer
  • Sun → Grass → Grasshopper → rats → snakes → owls
    6·1 answer
  • The global causes that drive those processes in Box 2
    7·1 answer
  • How many megaspores and how many sperm cells are involved in a double fertilization event?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!