1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
2 years ago
12

1. Which animal has the highest body temperature when the environmental temperature is 15 degrees Celsius?

Biology
1 answer:
tatyana61 [14]2 years ago
3 0

Answer:

1. C) Cat

2. D) 47 degrees C

3. B) Cat

You might be interested in
Which of the following correctly sequences the steps of the scientific method?
Minchanka [31]

Answer:

observe, question, make a testable explanation, experiment, collect and analyze data, state findings

Explanation:

5 0
3 years ago
Paano tinitingnan ang wika sa larangan ng linggwistika?
Phantasy [73]

Answer:

yaaa tinitingan ang loca las na lan sa utin con 10

Explanation:

5 0
3 years ago
Explain how dna, chromosomes, and genes are related pltw
AfilCa [17]
DNA make up the chromosomes that are then passed off to the parent's offspring. The DNA is in the chromosomes and it translates the genes to determine traits
4 0
2 years ago
25 x 8= ?<br>100 what is the answer​
Digiron [165]

25 x 8

8 x 5 = 40 you put the 4 on top of the 8 and put the zero as your first number on your answer

8 x 2 = 16

then you get the 4 on top of the 8 and then add 16

16 + 8 = 20

20 -- 0

200

plz mark me as brainliest :)

3 0
3 years ago
So if earth's orbit is closer to the sun than Mars'
Talja [164]

Answer:

i am not really sure if you meant how manyhours or is it longeror shorter to make full orbit.

Explanation:

4 0
3 years ago
Other questions:
  • Which are used to measure distances north or south of the equator?
    8·2 answers
  • Which physical characteristic of the neonate is typically present in the neonate of a primigravid mother?
    15·1 answer
  • You are on a call of a minor vehicle accident. your patient is a 22-year-old male who was the driver of a moderate t-bone collis
    13·1 answer
  • Which statements regarding hypotheses are true
    14·1 answer
  • can anyone Expain why it is important for Non scientists to understand how scientists use the terms Hypothesis, a guess and a th
    11·1 answer
  • What are examples of things that can cause mutations?
    15·2 answers
  • Air circulates in Earth's atmosphere. Which of the following is the fundamental cause of air
    14·1 answer
  • 95% of plastics in the ocean are
    13·1 answer
  • What are the flowers in the picture​
    11·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!