1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
7

8. James Madison wrote that "liberty is to faction what air is to fire." After reading this, Jack points out that the Founders w

ould have wanted more restrictions on lobbyists, special-interest groups, and media influencing the government. What would be a good counterargument?
A. Elected officials are better able to measure public opinion if there are no interfering factions
B. Lobbyists will balance one another in government influence if they are subject to fewer laws.
C. The media, despite its biases, are best able to monitor the government when they are free.
D. Political ads, despite their biases, are best able to interm citizens when there are no
regulations.
Law
1 answer:
Rudiy273 years ago
5 0

Answer:

The media, despite its biases, are best able to monitor the government when they are free.

Explanation:

You might be interested in
2 points
ra1l [238]

The answer should be Arizona v. United States (2012).  One of the main points brought up by this ruling was an Arizona state-law making it a crime for being unlawfully present in the United States. This made it more likely for a Hispanic person to be racially profiled by law enforcement.

I hope this helps! :)

7 0
3 years ago
Which neighborhood is affected by broken windows in broken windows theory an affluent neighborhood or a run down neighborhood
lina2011 [118]

Answer:

a run down neighbourhood

Explanation:

this theory is based on disordered areas, which will be more likely to have higher crime rates than affluent neighbourhoods.

4 0
4 years ago
Read 2 more answers
2. If rules are universal, or if rules are not universal - does that make you feel more secure in making a decision?
crimeas [40]

Answer:

According to me...I won't feel confident when making that decision because that decision will be based on the rules that I must follow and I also believe that when I'm taking a decision is going to be based on what situation you are in.

So decisions are not suppose to be based on rules because everyone have a right to take or make a decision that is suitable for themselves.

8 0
3 years ago
If Donald Trump and President Joe Biden ran against each other in 2024, who would you vote for?
Neko [114]

Answer:

Neither. I DONT LIKE ANY OF THEM

Explanation:

5 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Any distinction between civil and criminal is artificial. What does this statement mean?
    12·1 answer
  • Which of the following is the most habit-forming?
    15·1 answer
  • Me ayudan porfavor!!
    10·1 answer
  • Why is the speaker recognized as the head of the US Congress ?
    14·1 answer
  • Do you know any good websites to practice law? Please write them down with a link.
    9·1 answer
  • Civilians and military personnel enjoy the same constitutional guarantees when charged with a serious felony.
    13·2 answers
  • Wisconsin vs Yoder What other factors does Burger claim must be considered when mandating education requirements?
    8·1 answer
  • Reflect on the types of evidence you expect to be found and collected from the Willow Lane crime scene, and make a list of the t
    14·1 answer
  • Erin is a system administrator for a federal government agency. What law contains guidance on how she may operate a federal info
    7·1 answer
  • Courts normally do not enforce the terms of click-on agreements. Group of answer choices True False
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!