1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luden [163]
2 years ago
14

Which of the following leads to new discoveries and new series?

Biology
1 answer:
Tema [17]2 years ago
5 0

Answer:

I think it's letter C or A

You might be interested in
What do you mean by formatting text ?​
Liula [17]

What they mean by formatting text is ,to organise text in such a way that it becomes more attractive and easy to read

7 0
3 years ago
Why may an infection of the inner ear cause you to lose balance?
pishuonlain [190]
Hi
Inside your ear there is water this water is detected in your ear and a signal is send to your brains so you know your balanced. If you have an infection. This signal is blocked so you can't feel if you're balanced or not.
3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Select the correct responses to the questions from the drop-down menu.
mojhsa [17]

I belive they studied rocks because that is what geological stands for.However they also studied glaciers and ice caps for seeds that contained pollen. The prehistoric 4imes often help us understand out history.

4 0
2 years ago
Read 2 more answers
¿Qué tipo de célula apareció primero en la Tierra?:___, y se presentan en seres vivos como las:___ y se caracterizan porque:___.
Levart [38]

Answer:

Célula procariota y procariotas.

Explicación:

La célula procariota es un tipo de célula que apareció por primera vez en la Tierra hace unos mil millones de años. Estos tipos de células están presentes en los procariotas, lo que significa que estos organismos no tienen un núcleo verdadero o una membrana nuclear alrededor del núcleo y otros orgánulos de la célula. El ADN del organismo procariótico se encuentra en una parte central de la célula que se conoce como nucleoide. La pared celular de un procariota actúa como una capa adicional de protección, ayuda a mantener la forma y estructura celular y previene la deshidratación.

3 0
3 years ago
Other questions:
  • T is a trait for tallness in pea plants. the trait for shortness is t. in a case of simple dominance, what is the height of a pl
    5·2 answers
  • Which of the following are included in the binomial name given to an organism? End of exam A. Genus, species B. Species, family
    13·1 answer
  • Bacteria are organisms that reproduce asexually. how is this better for them than reproducing sexually?
    14·2 answers
  • Which characteristic describes the troposphere?
    6·1 answer
  • The adjacent of materials that follow a major earthquake often generate smaller earthquakes called
    11·1 answer
  • What do you think of when you hear the word science
    10·2 answers
  • What is the chance that the 4th child from the couple indicated by the arrow will have a girl who suffers from the disease?
    9·1 answer
  • Determine if the following statement is true or false. If true, choose TRUE. If false, choose the rewording that is true. Becaus
    6·1 answer
  • Interstellar clouds of dust where stars form are known as
    5·1 answer
  • Which environment is a bare area of land with few trees and plants and a lot of direct sunshine? (2 points)
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!