1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
12

Help again please thank you!

Mathematics
1 answer:
-Dominant- [34]3 years ago
6 0
2 one I think f//said
You might be interested in
Stanley drove his car on a business trip when he left the mleage was 840miles. And. when he returned the mileage was 1,200miles.
Elan Coil [88]
I think for this item, the rate at which the gasoline was consumed is to be calculated. To determine the distance that Stanley's car had traveled, we subtract 840 miles from 1,200 miles. That will give us an answer of 360 miles. Dividing this by 12 gallons will give us an answer of 30 miles/gal. 
3 0
4 years ago
Two parallel lines are cut by a transversal as shown below.
weeeeeb [17]
Angle one and angle two are supplementary, meaning that they add up to 180°.

180 - 58 = 122

Angle one and angle three are vertical angles, meaning that they are both the same angle.

Angle three = 122°
4 0
2 years ago
70% of 120 = 120x70/100 <br> How do you figure this out
Sati [7]
10% of 120 = 12
12 x 7 = 84
70% = 84

120 x 70 = 8400
8400 / 100 = 84

It’s either showing you that both sides of the equation equal to the same thing or that you can find 70% of 120 by using the steps on the right
3 0
3 years ago
What is the value of 6x – 3y if x = 5 and y=-1?<br>F. 11 G. 33 H. 65 1. 65​
atroni [7]

Answer:

it is G.33

brainliest plz

Step-by-step explanation:

7 0
3 years ago
Read 2 more answers
Absolute value of 13
natima [27]

Answer:

13.

Step-by-step explanation: the absolute value is the distance away from 0 a number is. 13 is 13 numbers away from 0. the absolute value of negative 5 would simply be 5 since it is still 5 units away from zero, even though it is a negative number.

6 0
3 years ago
Other questions:
  • URGENT TEST PLEASE HELP
    14·2 answers
  • Y=x+5 what is the slope?
    11·2 answers
  • Find the measures of the supplementary angles if their measures are in ratio of 11:25
    6·1 answer
  • The length of a rectangle is 2 cm more than 3 times its width. Find the length of the rectangle if the perimeter is 44 cm
    12·1 answer
  • Given the literal equation 2003-05-04-00-00_files/i0290000.jpg, with y = 4x + 2, what is the value of z if x = 1?
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help me!!! i’m so bad at math hahaha
    10·1 answer
  • Multiply the binomials and simplify your answer. (2x+9)(3x-5)
    8·2 answers
  • Using the image above, set up the equation that would help to determine the value<br> of angle x.
    7·1 answer
  • Run
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!