Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The urinary system removes excess substances and waste products from the metabolism from the body through the urine, contributing to the maintenance of homeostasis, the chemical composition of the internal environment. Urine is produced in the kidneys, passes through the ureters to the bladder, where it is stored and is released into the exterior through the urethra.
The kidneys perform the main work of the urinary system comparing with the other parts of the system, acting primarily as passageways and storage areas. With the filtration of blood and the formation of urine, the kidneys contribute to homeostasis of body fluids in a number of ways, such as: Regulation of the ionic composition of blood; Maintenance of blood osmolarity; Regulation of blood volume; Blood pressure regulation; PH regulation of blood; Hormone release; Regulation of blood glucose level; Waste excretion and toxic substances.
Ureters - They are two tubes that carry urine from the kidneys to the bladder. The ureters are capable of performing rhythmic contractions called peristalsis. Urine moves along the ureters in response to gravity and peristalsis.
Bladder - The urinary bladder acts as a temporary reservoir for urine storage. It is a hollow, elastic muscular organ that in men is directly anterior to the rectum and in women, is located in front of the vagina and below the uterus.
Urethra - is a tube that conducts urine from the bladder to the outside, being lined with mucosa that contains a large amount of mucus-secreting glands. The urethra opens outwards through the outer ostium of the urethra.
Answer:
it is implanted in the tissue of uterus.
Explanation:
the egg cell is usually fertilized in the oviduct and then sweeped out or moved out of the oviduct by cilia or peristaltic movements in the oviduct to the uterus. when it is moved to the uterus it is imolanted in the tissues there. give me a brainliest if i helped!♡
To find the correct location for injecting into the Gluteus maximus muscle, expose the buttocks and divide (in your mind) each buttock into four parts. Aim the injection into the upper quarter of the buttock (X on the diagram), towards the hip bone portion but below the iliac crest which is the bony part of the hip.
Answer:
The mass of an object is a measure of the amount of matter it contains. The weight of an object is a measure of the force exerted on the object by gravity, or the force needed to support it. Mass does not change with gravity as weight does due to the act of pulling down on an object making it in fact heavier.
Explanation:
^
