1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
8

Please help I really would appreciate it

Biology
1 answer:
vekshin13 years ago
4 0

Answer:

Light, electric

Explanation:

You might be interested in
What is the other name for the constellation seen here ?
swat32

Answer:

Another name of constellation is

group of star.

5 0
2 years ago
Which of these layers is typically thinnest?
valentinak56 [21]
Hello,


The answer is for sure <span>A. O horizon</span>.Positive.


Hope this helps
7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Meiosis begins with one haploid cell and ends with four diploid cells.<br> True<br> False
jasenka [17]
True ..In animals, the female mitotic sequence produces only one ovum; the other three haploid cells become "polar bodies".
4 0
3 years ago
Chaperone proteins or chaperones assist in the proper folding of proteins. Explain the process.
oksian1 [2.3K]

Proteostasis is mediated by chaperone proteins and protease systems, together with cellular clearance mechanisms such as autophagy and lysosomal degradation.

Chaperone proteins control assembly and inaccurate folding by binding to and stabilizing partly or completely unfolded protein polypeptides till the polypeptide chain is completely synthesized. Chaperone proteins also confirm the stability of unfolded polypeptide chains as they are being translocated into the subcellular organelles.

To learn more about Chaperone proteins here

brainly.com/question/28256423

#SPJ4

5 0
1 year ago
Other questions:
  • A. True
    15·1 answer
  • Codons are three-base sequences that specify the addition of a single amino acid. how do eukaryotic codons and prokaryotic codon
    13·1 answer
  • What substance make up 75 to 90 percent of every cell in the human body
    7·2 answers
  • Evidence has been found that shows that primate ancestors developed the ability to see color. Previously, like most mammals, the
    8·2 answers
  • HELP whoever gets right will be marked brainliest
    9·1 answer
  • How are codominant alleles and incompletely dominant alleles similar how are they different?
    12·1 answer
  • What is the answer plz ?
    8·1 answer
  • Identify each of the following molecules as reactants or products of the Krebs cycle.
    14·2 answers
  • When an object moves relative to an observer, the wavelength of
    8·1 answer
  • Chemical weathering ___.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!