One electron is transferred in the ionic bond because sodium needs to lose one electron and chlorine needs to gain one electron to have a full energy shell, which is the ultimate goal in any bond.
Brainliest please :)
Answer: unfavourable ph condition for the pepsin
Explanation: during digestion, enzymes are needed to aid the process.digestive enzymes are biological catalyst that breakdown large food particles into digestible form .
As biological catalyst, enzymes require an optimum temperature and pH condition.outside this temperature or pH,the enzyme is denatured.
In the stomach, hydrochloric acid is required to convert pepsinogen into it's active form,pepsin.the acid also creates an optimum low pH that pepsin needs to function.
As the food moves to the small intestine,the pH is alkaline and is unfavourable for pepsin to function.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The statement about the tundra that is true is that there are two main categories of the tundra biome.
Answer:
1.) a
2.) b
3.) c
4.) a
5.) b
6.) Are there any other options? none of those options are right because energy is released from ATP when a phosphate group is removed.