1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reika [66]
3 years ago
6

Adaptations of the chloroplast​

Biology
2 answers:
zepelin [54]3 years ago
7 0

Answer:

Chloroplasts are the ’solar energy plants’ of a cell – they convert light energy into chemical energy

This chemical energy may be either ATP (light dependent) or organic compounds (light independent)

Only photosynthetic tissue possess chloroplasts (e.g. is present in leaves but not roots of plants)

Chloroplasts are thought to have once been independent prokaryotes that were internalised by eukaryotes via endosymbiosis

They have a double membrane structure (due to vesicular coating as part of the endocytotic process)

They have their own DNA (circular and naked) and ribosomes (70S)

Their metabolic processes are susceptible to certain antibiotics

The structure of the chloroplast is adapted to the function it performs:

Thylakoids – flattened discs have a small internal volume to maximise hydrogen gradient upon proton accumulation 

Grana – thylakoids are arranged into stacks to increase SA:Vol ratio of the thylakoid membrane

Photosystems – pigments organised into photosystems in thylakoid membrane to maximise light absorption

Stroma – central cavity that contains appropriate enzymes and a suitable pH for the Calvin cycle to occur

Lamellae – connects and separates thylakoid stacks (grana), maximising photosynthetic efficiency

Explanation:

please mark me as brainliest

Tanya [424]3 years ago
5 0

Answer:

The adaptions of the chloroplast are thykalods which increases hydrogen gradient protons, it also has pigments that make light rlly large which is called photosystems :3

Explanation:

:3

You might be interested in
Answer plz if u can I need help​
Sveta_85 [38]
The correct answer is C
4 0
3 years ago
Along with Louis Pasteur, what other scientist helped to disprove spontaneous generation? Eli Germ John Snow Francesco Redi Robe
Nataly_w [17]
<span>Francesco Redi is the answer.</span>
4 0
3 years ago
Read 2 more answers
Kalie, age 18, is prescribed progesterone for the treatment of primary amenorrhea. which adverse effect would need to be reporte
padilas [110]
The answer would be: C. Pain in one leg

The pills could cause several side effects like gaining weight or breast tenderness but it was not dangerous. The side effects that need to be reported is a pain in one leg which indicate a deep vein thrombosis.
Lump in the breast also dangerous as it indicates a breast tumor/cancer.
8 0
3 years ago
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
if a recessive allele helps an organism reproduce but the dominant allele hinders reproduction which will be more common in a po
PolarNik [594]
Recessive allele because dominant allele hinders organisms from reproducing which means that there is lesser of it with dominant allele
5 0
3 years ago
Read 2 more answers
Other questions:
  • Butterflies show r-selection traits. What does this statement imply?
    13·2 answers
  • Sally's teacher asked her to classify the organisms in a sample of pond water. One KEY feature can be seen that helped Sally rul
    7·2 answers
  • Selective breeding in the process of choosing the best characteristics of organisms through many generations to improve the vari
    15·1 answer
  • A zygote is the product of fertilization. The diploid zygotes of the four organisms seen here all underwent __________ and _____
    10·2 answers
  • Help f f f f f f ffff f f f
    5·2 answers
  • Succession continues until it reaches a ............... community.​
    9·2 answers
  • The directions for making a protein
    14·1 answer
  • Select the correct answer.
    13·2 answers
  • In classification, the group directly larger than species; first part of name in binomial nomenclature.
    10·1 answer
  • What are the changes that one can expect to observe as a plant tissue culture develops?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!