Quantitative Data is the correct answer thatyou are looking for.
Answer:
Convergent evolution
Explanation:
Convergent evolution is a type of evolution of similar features and/or structures between organisms that are not phylogenetically related. This type of evolution is known to create analogous structures/organs that exhibit similar or the same functions but were not present in the last common ancestor of these taxa. An example of analogous structures (and therefore also of convergent evolution) are the wings of bats and of insects (e.g., butterflies). Conversely, divergent evolution is a type of evolution where species phylogenetically related, i.e., species that share a common ancestor, evolve and accumulate differences over time.
Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Answer:
The steps will be in order in the sequence 12,13,11,4 and 15
Explanation:
12. In glycolysis, glucose is converted into pyruvate. ATP and NADH ARE MADE.
13. Pyruvate is oxidized and converted into acetyl CoA in the mitochondria. Carbon dioxide and NADH are also made.
11. The acetyl CoA undergoes a series of changes and ATP, FADH2, NADH, and carbon dioxide are released.
4. NADH and FADH2 lose their electrons and get converted back into NAD+ and FAD.
15. Oxygen takes electrons and water is produced. 34 ATP molecules are released.
False, there are lots of biomes on earth.
