1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
salantis [7]
3 years ago
13

2 points

Biology
1 answer:
Hunter-Best [27]3 years ago
5 0
A it is just a theory, it is not fully proven as a law
You might be interested in
What role do elements<br> play in chemical<br> reactions?
wel
Chemical reactions are how new forms of matter are made. While nuclear reactions also may produce new matter, nearly all the substances you encounter in daily life are the result of chemical changes. Chemical reactions help us understand the properties of matter
5 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
How many amino acids are necessary for the human body to function properly?
Aleksandr-060686 [28]

Answer:

b, 8-10

Explanation:

your body needs 20 amino acids to grow, repair and function, however, only nine amino acids are 'essential' as such.

they are histidine, valine, isoleucine, methionine, phenylalanine, threonine, tryptophan, leucine, and lysine

hope this helps! :)

3 0
2 years ago
Read 2 more answers
What is the correct order of organization for populations from least to most complex
ahrayia [7]
Populations 
communities
ecosystem
biosphere

8 0
3 years ago
Introduced species can threaten biodiversity because they _____
Solnce55 [7]
The answer to this is A
5 0
3 years ago
Read 2 more answers
Other questions:
  • 13
    11·2 answers
  • Why do chris and zach want to replace their beans and rice with corn?
    14·1 answer
  • What is one bioethical concern with using embryonic stem cells for regenerative medicine?
    10·2 answers
  • Why can we sometimes hear noises in the stomach during digestion???
    14·1 answer
  • Coals ,oils and gas are examples of
    6·1 answer
  • Fill in the chart each creature
    6·1 answer
  • Which two elements have similar characteristics?<br> Periodic Table<br> OF The Elements
    6·1 answer
  • The blue cell in the cartoon would be classified as what type of cell?
    5·2 answers
  • What are 4 functions of proteins?
    13·1 answer
  • Which endocrine organ is responsible for the production of adh oxytocin and regulatory hormones?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!