The answer is nucleus (structure A)
because nucleus DNA would be destroyed
~ B - Adding wood to a burning fire to increase the heat.
A is kind of like a reaction to negative feedback - it's too hot, so cooling down.
C is like turning the air conditioner off. It's cool enough.
B on the other hand adds something to the whole by reinforcing it. The fire is a metaphor for the writer's self-esteem, ego, good-feelingness, what-have-you.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
A short cat could be 1 inch. A long tail depending on the cat could be twice as long as body length . what type of cat is it.
Lll. a limited supply of necessary resources. If there isn't enough resources the species will have to learn to adapt to be able to gather the new food supply they need. Such as birds and there beaks, if the insects population went down and that was the main food supply for that type of bird they would have to be able to adapt in order to survive, so evolution occurs. Over time that bird would change to adapt to its new feeding source.
Hope this helps!
