1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitriy789 [7]
2 years ago
9

Answer The following with ᵒF and ᵒC.

Biology
1 answer:
Alekssandra [29.7K]2 years ago
5 0

I hope i am right

Explanation:

1. 20⁰F

-4⁰C

2.46⁰F

8⁰C

3.18⁰F

-8⁰c

You might be interested in
Meiosis produces _____ daughter cells.<br><br> 1<br> 2<br> 3<br> 4
bulgar [2K]
4 daughter cells

~~~owowowowowowowow~~~~
5 0
3 years ago
Read 2 more answers
How are important properties of mercury venus and mars different from important properties of earth?
Gnoma [55]
<span>Mars is a little more than half the size of the earth.It is reddish in colour unlike earth.Earth has oneoon, Mars has two moons.Jupiter is larger than earth.Jupiter has four rings whereas earth does not have any.Earth is suitable for life due to the presence of water ,but Mercury has a toxic atmosphere.Mercury is hotter than earth.</span>
8 0
3 years ago
The difference between osmosis and diffusion is that osmosis is the spreading of water from a high to low concentration while di
r-ruslan [8.4K]
Yes - diffusion is a broad term that may be applied to a vast number of substances and is not limited to liquids ( gases can diffuse too). osmosis refers to the diffusion of liquid water down the water potential gradient
5 0
3 years ago
Question 4: Suppose there were changes in the habitat that caused this actual value. What might a combination of those changes b
Valentin [98]

Answer:

hmmmm check my explanation

Explanation:

it my be from many different mishaps

such as tsunamis, earthquakes, volcanic eruptions and more

3 0
3 years ago
The broadest classification level for organisms is
wel

Answer:

Archaea

Explanation:

6 0
3 years ago
Other questions:
  • What are typical signs and symptoms for a urinary tract infection?
    8·1 answer
  • Which stage of the cell cycle involves the division of the cell’s nucleus?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • 2. A flower arranger is growing some flowers in a garden. He has
    5·1 answer
  • What is the difference between molecules and compounds?
    14·1 answer
  • QUE ES ELECTRIZACIÓN​
    11·1 answer
  • Which of the following are physical geographic features? ​
    13·1 answer
  • Can someone help out please
    8·2 answers
  • In genetics, the PHYSICAL characteristic (tall, short, round, wrinkled) of an
    7·1 answer
  • What is the chemical energy molecules used by cells
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!