1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
12

Which event occurs during interphase​

Biology
1 answer:
Basile [38]3 years ago
7 0

Answer:

The Interphase carries out metabolic processes.

You might be interested in
What are the two requirements for something to be matter
Juli2301 [7.4K]

Answer:

The two requirements for something to be matter are

1. Mass

2. Volume

4 0
3 years ago
Read 2 more answers
50. The flow chart below shows how a metamorphic rock can change into a
max2010maxim [7]

Answer:

The process that would be the correct label to replace the question mark in this question is:

B) Deposition

Explanation:

Deposition takes place after erosion of sedimentary rock.  At this stage, the eroded sedimentary rocks build up under high pressure heat, wind, ice, water, and other natural forces to originate the rock formation cycle once again.  Naturally, after deposition, the igneous rocks, which have then layered up sedimentary rocks to become metamorphic rocks.

5 0
3 years ago
Sound wave vibrations are transmitted by three tiny bones located in the
Sauron [17]
Located in the Middle ear
8 0
3 years ago
Read 2 more answers
By age 65, what percentage of adults are grandparents? 75 80 85 90
frutty [35]
85% of adults are grandparents by age 65. This estimation has been made in the U.S. from the surveying of the elderly. So, the correct choice is the third option: 85. 

Let me know if you need further info. :)

                - Dotz
7 0
3 years ago
In what era did the plants begin to flourish?
Juliette [100K]

Answer: Paleozoic

Explanation: The Paleozoic Era, which ran from about 542 million years ago to 251 million years ago, was a time of great change on Earth. The era began with the breakup of one supercontinent and the formation of another plants became widespread. And the first vertebrate animals colonized land.

6 0
3 years ago
Other questions:
  • Virulent viruses multiply infected cells and eventually cause the cell release new viruses by a process called
    7·1 answer
  • The rise in blood glucose levels after eating stimulates the pancreas to secrete the hormone ___, causing blood glucose levels t
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Early land animals had gills as well as lungs. Please select the best answer from the choices provided T F
    8·2 answers
  • Which best matches a list that a scientist would make to describe a forest ecosystem?
    9·2 answers
  • The water content of a typical human cell is around 65 - 70%. Using your knowledge of cellular anatomy and physiology, what is t
    15·1 answer
  • Which characteristics is common of developing countries?
    15·1 answer
  • Whales, humans, lizards, and birds each have forelimbs that are adapted for different functions, including swimming, using tools
    9·1 answer
  • A hypothesis is a(n) ______________, while a theory is a(n) ______________.
    14·1 answer
  • Yeasts reproduce by budding. During budding, a yeast cell splits into two cells. Then the two cells split, making four cells. De
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!