1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
11

Which statement is true???

Biology
1 answer:
adell [148]3 years ago
7 0

Answer:

I believe it's the second one sorry I'm late to this question

Explanation:

You might be interested in
Do dandelions have a fibrous root system or a tap system
nikklg [1K]
Dandelions have a tap system not a fibrous system.
7 0
3 years ago
How is coal, petroleum, and natural gas formed underground?
zvonat [6]

Answer:

Like coal and natural gas, petroleum was formed from the remains of ancient marine organisms, such as plants, algae, and bacteria. Coal, natural gas, and petroleum are all fossil fuels that formed under similar conditions. Today, petroleum is found in vast underground reservoirs where ancient seas were located.

<em><u>H</u></em><em><u>o</u></em><em><u>p</u></em><em><u>e</u></em><em><u> </u></em><em><u>t</u></em><em><u>h</u></em><em><u>a</u></em><em><u>t</u></em><em><u> </u></em><em><u>h</u></em><em><u>e</u></em><em><u>l</u></em><em><u>p</u></em><em><u>s</u></em><em><u>:</u></em><em><u>)</u></em>

7 0
2 years ago
Read 2 more answers
What would be the pros and cons of using Linnean and modern classification system?
Anna71 [15]
<span><span>#1) What would be the pros and cons of using Linnean and modern classification system?

</span><span>Answer: The pros of using the Linnean classification system is that it conveys a very detailed information about the species and the closest relatives of living things. It helps scientists to understand the complex relationships. A con is that it takes a very large amount of information and time for this system to develop.

</span><span>I hope it helps, Regards.</span><span>
</span></span>
5 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Pathophysiology and treatment of type 2 diabetes: perspectives on the past, present, and future.
Mice21 [21]
Type two is where their are to much insulin but not enough glucose that's all I can say sorry
3 0
3 years ago
Other questions:
  • During the rainy season, and just as the dry season starts, food is abundant for all finches. However, as the dry season wears o
    5·1 answer
  • Suppose members of a true-breeding strain of salamanders with yellow stripes are crossed with a true-breeding strain with red st
    7·1 answer
  • What are some characteristics of scientific questions ?
    6·1 answer
  • plz help asap..Consider this statement: Earth is the only source of gravity in the solar system. Do you agree? Give your reasons
    13·1 answer
  • The energy of motion is called _____.  
    5·2 answers
  • What problems do invasive species pose to an ecosystem?
    11·1 answer
  • Katlyn makes a gelatin dessert. She pours hot water into the flavored gelatin powder and stirs. What are the solute and solvent
    13·2 answers
  • Much of an ocean beach is covered in sand dunes and grasses. The homeowners along the beach propose to flatten out the dunes and
    15·1 answer
  • Suppose you have two identical solutions of glucose, A and B. The solutions are separated by a permeable membrane that will allo
    11·1 answer
  • What one word should help you describe and understand reflection?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!