Dandelions have a tap system not a fibrous system.
Answer:
Like coal and natural gas, petroleum was formed from the remains of ancient marine organisms, such as plants, algae, and bacteria. Coal, natural gas, and petroleum are all fossil fuels that formed under similar conditions. Today, petroleum is found in vast underground reservoirs where ancient seas were located.
<em><u>H</u></em><em><u>o</u></em><em><u>p</u></em><em><u>e</u></em><em><u> </u></em><em><u>t</u></em><em><u>h</u></em><em><u>a</u></em><em><u>t</u></em><em><u> </u></em><em><u>h</u></em><em><u>e</u></em><em><u>l</u></em><em><u>p</u></em><em><u>s</u></em><em><u>:</u></em><em><u>)</u></em>
<span><span>#1) What would be the pros and cons of using Linnean and modern classification system?
</span><span>Answer: The pros of using the Linnean classification system is that it conveys a very detailed information about the species and the closest relatives of living things. It helps scientists to understand the complex relationships. A con is that it takes a very large amount of information and time for this system to develop.
</span><span>I hope it helps, Regards.</span><span>
</span></span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Type two is where their are to much insulin but not enough glucose that's all I can say sorry