1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
2 years ago
11

Based on fossil data, the researcher estimates that humans and their most closely related species in the data set diverged appro

ximately seven million years ago. Using these data, calculate the rate of mtDNA percent divergence per million years between humans and their most closely related species in the data set. Round your answer to two decimal places.
Biology
1 answer:
tester [92]2 years ago
5 0

Answer:

Hello your question is incomplete attached below is the complete question

answer : = 1.25

Explanation:

i) Determine the rate of mtDNA percent divergence

From the data given the most closely related specie is Chimpanzee ( 8.8 sequence  difference )

Note : Given that this divergence took place seven million years from now

∴The rate of mtDNA percent  divergence per 1 millions years

= 8.8 / 7 = 1.25

You might be interested in
How is the FOG produced?
gayaneshka [121]
Fog begins to form when water vapor condenses into tiny liquid water droplets that are suspended in the air.
3 0
2 years ago
Read 2 more answers
What are two parts that all fish share
Inessa [10]
Organs , fins is the correct answer
7 0
3 years ago
Which of the following is not a type of galaxy?
TEA [102]
There are three main types of galaxies<span>: Elliptical, Spiral, and Irregular. Two of these three </span>types<span> are further divided and classified into a system that is now known the tuning fork diagram. When Hubble first created this diagram, he believed that this was an evolutionary sequence as well as a classification.</span>
6 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What traits of a panda bear do not fit its niche ?
nignag [31]

Explanation:

does this come for a story or is just a question?

4 0
2 years ago
Other questions:
  • What happens to energy as it goes up the food pyramid
    9·2 answers
  • Skin cancer is to exposure to uv radiation as
    14·1 answer
  • The interaction between nature and nurture has been shaping the human mind over millennia. one of the ways science has tried to
    9·1 answer
  • What cellular processes are “hijacked” by viruses?
    9·1 answer
  • Question: It is hard to believe, but the desert and the tundra have a lot in common! The most obvious is that both biomes have l
    5·1 answer
  • What is the major function of asters of centrosome in a cell ?
    15·1 answer
  • The boy wanted to say something other than, "Thank you, m'am," to Mrs. Luella Bates Washington Jones, but although his lips move
    8·2 answers
  • The cells of certain eukaryotic organisms, such as vertebrates and plants, often methylate the cytosines in their DNA, producing
    8·1 answer
  • Un objeto posee una energía cinética de 300J, este mismo se ubica a 4m de altura y su masa corresponde a 10Kg. ¿Cuál es su energ
    13·1 answer
  • When an invasive species is introduced into a new habitat where it has no natural predators, it can quickly populate. Which best
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!