1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
14

What are 2 ways yo conserve water

Biology
1 answer:
Phoenix [80]3 years ago
8 0
Leave the faucet off while brushing your teeth and cut shower time
You might be interested in
Which is the smallest unit of life?
zysi [14]

Answer:

D, cells.

Explanation:

7 0
3 years ago
Read 2 more answers
Alexander was studying the affect of playing rock music on plant growth. One of the plants was exposed to rock music for 24 hour
attashe74 [19]
C) the answer is c 8 decimeters
5 0
3 years ago
Read 2 more answers
What is the single source of both electrons used by AND the oxygen created by photosynthesis? During which part of the process d
Airida [17]

Water is the single source as it provides the electrons by splitting into oxygen and hydrogen. This process happens during the light-dependent reactions.

7 0
1 year ago
How do you think it is possible to create over 100 000 different proteins from just 20 amino acids?
never [62]
<span>Protein is made up of building blocks called amino acids</span>
3 0
3 years ago
To compare the relative ages of fossils, scientists sometimes use an easily recognized
Natalka [10]
<h2>Answer:</h2>

The fossil is <u>A) </u><u>Index fossil</u>.

<h2>Explanation:</h2>

Index fossils refer to the type of fossil which is used to characterize and distinguish geologic periods. Due to this function of index fossil, they are also called as guide fossil or indicator fossil.  These fossils must have a short vertical range, wide geographic circulation, and quick developmental patterns.

Another term, Zone fossil is utilized when the fossil have every one of the characters expressed above with the exception of wide topographical dispersion, they are restricted to a zone and can't be utilized for relationships of stratas.

7 0
3 years ago
Other questions:
  • What is the difference between a parent isotope and a daughter isotope?​
    5·1 answer
  • Three liquids with different densitits are dumped into a glass what do you expect to see
    12·2 answers
  • What is the evalution of managment​
    10·1 answer
  • The Sargasso Sea, which Bermuda is in the middle of, is a huge nursery for over ______ species of ocean life, meaning they ONLY
    11·1 answer
  • Which statement about endotherms and ectotherms is correct?
    8·1 answer
  • A student hypothesized that pillar coral digest zooxanthellae for energy. Which prediction is based on the student's hypothesis?
    15·2 answers
  • Which of the following are compounds? (Choose all that apply.)
    6·1 answer
  • BRAINLIESTTT ASAP!!!!
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • In arteriosclerosis, overproduction of abnormal collagen and decreased quantities of elastin lead to what?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!